Rescue of Synthetic Measles Virus Minireplicons: Measles Genomic Termini Direct Efficient Expression and Propagation of a Reporter Gene

Abstract

Measles virus (MV) mRNA transcription and replication are thought to be controlled by cis-acting sequence elements contained within the terminal MV genomic noncoding nucleotides. To validate these promoter and regulatory signal assignments, cDNAs were constructed allowing synthesis of RNAs corresponding to a MV genome in which all coding and intercistronic regions were replaced by the chloramphenicol acetyl transferase (CAT) coding sequence. Transcript production by T7 polymerase starting and ending precisely with the MV genome terminal residues was achieved by fusing the T7 polymerase promoter and the hepatitis delta virus genome ribozyme followed by tandem T7 polymerase termination sequences to the MV genomic 5' and 3' ends, respectively. Transfection of these negative polarity transcripts, mimicking natural defective interfering RNAs of the internal deletion type, into MV-infected 293 cells gave rise to CAT activity which could be serially transferred and massively amplified together with progeny helper virus in fresh cells. Transfer was blocked only by antibodies able to neutralize MV infectivity, indicating that the chimeric RNA not only was encapsidated, transcribed, and replicated, but also packaged into virions. Sequence analyses confirmed that both the expected chimeric antigenome and mRNA products were transcribed and replicated with fidelity during serial passage. Minor changes introduced in the transcription promoter markedly compromised function. This system now can be exploited to examine MV genomic cis-acting regulatory elements and extended to the development of full-length MV cDNAs.

The C, V and W proteins of Nipah virus inhibit minigenome replication

“…To determine whether the C, V and W proteins of the henipavirus NiV also possess the ability to regulate replication of the viral genome, a plasmid-based minigenome assay was used. A similar approach has been used to study the regulation of viral genome replication for multiple paramyxoviruses, including MV (Bankamp et al, 2002Reutter et al, 2001;Sidhu et al, 1995), hPIV3 (Durbin et al, 1997Malur et al, 2004;Smallwood & Moyer, 2004), Sendai virus (SeV) (Tapparel et al, 1997), simian virus 5 (SV5) (Lin et al, 2005), respiratory syncytial virus (Atreya et al, 1998), rinderpest virus (Brown et al, 2005, peste-des-petits-ruminants virus (Bailey et al, 2007), J-virus and Beilong virus (Magoffin et al, 2007). We demonstrated that NiV C, V and W proteins inhibit CAT expression from the NiV minigenome in a dosedependent manner.…”

Rescue of Mumps Virus from cDNA

“…To find conditions suitable for the rescue of infectious virus from a genome cDNA, a synthetic MUV minireplicon similar to those described for influenza virus and members of the Paramyxoviridae and Rhabdoviridae was assembled so as to contain the CAT reporter gene (5,7,8,20,24,28,35). Initially CAT activity was rescued by transfection of MUV-infected 293 cells with RNA transcribed from this construct in vitro.…”

“…The CAT ORF cDNA was amplified using primers 5ЈATCATTCGTCTCGGAAAATGGAGAAAAA AATCACTGGATATACC and 5ЈATCATTCGTCTCTCGATTTACGCCCCG CCCTGCCACTC. All three cDNA components were gel purified, trimmed with BsmBI, joined together in a four-way ligation, and cloned into the NotI/NarI sites of modified pBluescript KS(ϩ) (35) to produce the complete minireplicon plasmid, pMUVCAT (Fig. 1).…”

Independent Structural Domains in Paramyxovirus Polymerase Protein

“…Replicon Reporter Systems-Base vectors for all MeV replicon experiments were previously reported plasmids containing the MeV-Edmonston (Edm) strain-derived L, N, or P open reading frames under the control of the T7 promoter (27). To generate an MeV luciferase replicon reporter construct, the terminal untranslated regions of the MeV genome were added to the firefly luciferase open reading frame (Promega) through recombination PCR (all oligonucleotide primers used in this study are listed in supplemental Table 1, entries #1-7) followed by replacement of the chloramphenicol (CAT) reporter cassette in the previously reported MeV-CAT replicon plasmid (27) with the sequence-confirmed recombination product.…”