Resolution of a common RNA sequencing ambiguity by terminal deoxynucleotidyl transferase

Abstract

One of the more common ambiguities which arise when using reverse transcriptase and dideoxynucleotide-chain termination to sequence RNA is a radioactive band of cDNA that extends over all four lanes on a sequencing gel. The adjacent sequences both above and below the band are not affected. Assuming then, that these ambiguities are caused by the termination of the DNA polymerase activity of reverse transcriptase for reasons other than the insertion of a dideoxynucleotide in the growing cDNA chain, terminal deoxynucleotidyl transferase should be able to continue to add deoxynucleotides to these products after the sequencing reaction is complete. It does, clearing the improperly terminated cDNA from these pileup sites, revealing the correct sequence. This technique can also be used to identify the template RNA's 5'-terminal base, although far more units of terminal deoxynucleotidyl transferase are required.

The nucleotide sequence and genomic organization of grapevine virus B

“…3 a) suggesting the presence of a cap (Ahlquist & Janda, 1984). TdT treatment (DeBorde et al, 1986) confirmed that the RNA is capped and showed the first nucleotide to be adenine (Fig. 3 b).…”

“…Primer GB10 (5' CAGGGCTGCACTTGCAACAC 3'), complementary to nt 73-92 of the viral RNA, was labelled with polynucleotide kinase and [32P]dATP and extended by reverse transcription (Meshi et al, 1983). The 5'-terminal nucleotide was determined by terminal deoxynucleotidyl transferase (TdT) treatment according to DeBorde et al (1986).…”

Characterization of two antigenic sites recognized by neutralizing monoclonal antibodies directed against the fusion glycoprotein of human respiratory syncytial virus

“…Total RNA was isolated by the isothiocyanate-CsCl method (Chirgwin et al, 1979) and poly(A) + RNA was selected by oligo(dT)-cellulose chromatography. These mRNA preparations were used for sequencing by the dideoxynucleotide chain termination method (Sanger et al, 1977) using reverse transcriptase and 5'-32p-labelled oligonucleotides, followed by a chase with terminal deoxynucleotidyl transferase (DeBorde et al, 1986). The primers used for sequencing were synthesized according to the reported sequence of the Long strain F protein gen e and their composition can be obtained from the authors upon request.…”

The nucleotide sequence of citrus leaf rugose ilarvirus RNA-2

“…DNA from clones pB11, pB14 and pA3 was sequenced in both directions using an automated 373A DNA sequencer (Applied Biosystems). The 5' end sequence of the CiLRV RNA-2 was determined by reverse transcription sequencing using an internal oligonucleotide primer (5' GGGATCTCAAACGTGGC) and terminal deoxynucleotidyl transferase (DeBorde et al, 1986). Nucleic acid sequences were compared and/or translated using either programs in the GCG analysis package or by using Gene Jockey software.…”