Restriction Endonuclease Analysis and Molecular Cloning of Porcine Adenovirus Type 3

Abstract

The 6618 strain of porcine adenovirus type 3 was cultivated in swine testis cells, and viral DNA was extracted from the infected cells by a modified Hirt procedure. The DNA was digested by each of 13 restriction endonucleases, and the number of cleavage sites which were identified varied from 1 to 17. The size of the porcine adenovirus type 3 genome, estimated from the sizes of the restriction enzyme fragments, was approximately 35 kb. Fragments representing the entire genome were cloned. Physical maps were constructed based on the results of restriction endonuclease analyses and hybridization and oriented with respect to the genome of bovine adenovirus type 3.

Development of porcine adenovirus-3 as an expression vector.

“…Figs 1 and 2 summarize the strategy used for construction of plasmids used in the study. Plasmid p3SB (Reddy et al, 1993), containing the left end of the PAV-3 genome (position 1-8870), was used for amplification of the first 433 bp of the genome in PCR using oligonucleotides 1 (5' GCGGATC-CTTAATTAACATCATCAATAATATACCGCACACTTTT 3') and 2 (5' CACCTGCAGATACACCCACACACGTCATCTCG 3'), where the adenoviral sequences are shown in bold and the engineered restriction enzyme sites are italicized. The amplified PCR product harbours the left ITR and the packaging signal.…”

“…The amplified PCR product harbours the left ITR and the packaging signal. Plasmid p3SA (Reddy et al, 1993) contains the right end of the PAV-3 genome and was used as a template in PCR for amplification of the terminal 573 bp of the genome using oligonucleotides 1 and 3 (5' CACCTGCAGCCTCCTGAGTGTGAAGA-GTGTCC 3'). The primers were designed based on nucleotide sequence information described elsewhere (Reddy et al, , 1997.…”

“…The DNA fragments of various recombinant plasmids of PAV-3 were transferred from agarose gels to Nytran membranes (Schleicher and Schuell) as described (Reddy et al, 1993). The genes encoding PRV gD and CAT were labelled with [$#P]dCTP by the random primer labelling technique.…”

“…Hybridizations were carried out at 42 mC in the presence of 50 % formamide. Prehybridization, hybridizations and washing of membranes were carried out as described (Reddy et al, 1993).…”

“…As steps towards that goal, cloning and physical mapping of the DNA (Reddy et al, 1993), nucleotide sequence analysis of the E1, E3 and E4 regions and inverted terminal repeats (ITRs) (Reddy et al, a, b, 1996(Reddy et al, , 1997, and of a few late region genes (McCoy et al, a, b, 1997 of PAV-3 have been completed. Recently, determination of the complete nucleotide sequence and transcription map of the genome has indicated that the genetic organization in PAV-3 is collinear to that of human adenoviruses (HAVs) .…”