Reverse genetics in high throughput: rapid generation of complete negative strand RNA virus cDNA clones and recombinant viruses thereof

Nolden, Tobias; Pfaff, Florian; Nemitz, Sabine; Freuling, Conrad Martin; Höper, Dirk W.; Müller, Thomas; Finke, Stefan

doi:10.1038/srep23887

Cited by 24 publications

(41 citation statements)

References 39 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…RABV isolates used in this study comprised five recombinant virus clones and one non-recombinant lab virus. The recombinant field virus clones rRABV Dog and rRABV Fox have been described before [42]. SAD L16 is a recombinant virus clone of attenuated vaccine virus SAD B19 live vaccine virus [43].…”

Section: Virusesmentioning

confidence: 99%

“…A cDNA full length clone (pRABV Rac) from a raccoon RABV isolate (Alabama, USA 1991; FLI archive ID N 13205) [46] was generated by full length RT-PCR amplification of the 12 kb cDNA genome with the primer pair 5 -TCGATCCCGGGTCACGCTTAACAACAAAA-3 / 5 -TAATACACCTGCCCATGCCGACCCACGCTTAACAAAAAAACAA-3 . After PCR amplification of a 2.7 kb vector DNA fragment from pCMV HaHd ampR Br 322 ori with the primers 5 -TCTGTTTGCTTGATGGTTTTTTTTGTCTTTGTTGTTTTTTTGTTAAGCGTGGGTCGGCATGGC ATCTCCAC-3 and 5 -TTTTTGTAGATGATACTGTCTACTTCTTCTCTGATTTTGTTGTTAAGCGTGA CCCGGGACTCCGGGTTTCGTC-3 , the fragments were combined by linear to linear recombination, and the resultant recombinant rRABV Rac virus was rescued and amplified according to previously described protocols [42]. The sequence of the full-length cDNA clone was deposited at GenBank (accession no.…”

Section: Virusesmentioning

confidence: 99%

“…The resultant fragments were assembled in combination with EcoRI-linearized 3.4 kb vector plasmid pCVS-11-termini by Hot Fusion reaction [47]. Plasmid pCVS-11-termini was generated by PCR amplification of a 2.7 kb DNA fragment from pCMV HaHd ampR Br 322 ori [42] with the primers 5 -GACCCGGGACTCCGGGTTTC-3 and 5 -GGGTCGGCATGGCATCTCCA-3 , and Hot Fusion assembly with a synthetic DNA fragment containing the CVS-11 (accession no. LT839616) regions from nucleotide positions 1-580 (3 -genome end) and 11759-11927 (5 -genome end) separated by a non-viral EcoRI restriction site.…”

Section: Virusesmentioning

confidence: 99%

“…To minimize animal experiments, archived PFA-fixed brains from previous pathogenicity trials [42] were used for the analysis of rRABV Dog and rRABV Fox virus infections in mice. Similar to the mouse experiments with rRABV Rac, rCVS-11, ERA, and SAD L16 described above, mice were inoculated via the i.c.…”

Section: Archived Mouse Brains Infected With Rrabv Dog and Rrabv Foxmentioning

confidence: 99%

“…Whereas rRABV Fox and rRABV Dog caused disease even after infection with a very low virus dose [42], infections with rRABV Rac, rCVS-11, and ERA did not show any clinical signs at a dose of 10 2 TCID 50 (Supplementary Figure S3). High dose infection with the ERA strain (10 5 TCID 50 ) led to 100% disease development (Supplementary Figure S3c), whereas high dose infections with rRABV Rac and rCVS-11 only caused disease in 50% and 16.7% of the infected mice, respectively (Supplementary Figure S3a,b).…”

Section: Astrocyte Infection By Rabv Depends On the Type Of Virus (Fimentioning

confidence: 99%

See 4 more Smart Citations

Astrocyte Infection during Rabies Encephalitis Depends on the Virus Strain and Infection Route as Demonstrated by Novel Quantitative 3D Analysis of Cell Tropism

Potratz

Zaeck

Christen

et al. 2020

Cells

Self Cite

View full text Add to dashboard Cite

Although conventional immunohistochemistry for neurotropic rabies virus (RABV) usually shows high preference for neurons, non-neuronal cells are also potential targets, and abortive astrocyte infection is considered a main trigger of innate immunity in the CNS. While in vitro studies indicated differences between field and less virulent lab-adapted RABVs, a systematic, quantitative comparison of astrocyte tropism in vivo is lacking. Here, solvent-based tissue clearing was used to measure RABV cell tropism in infected brains. Immunofluorescence analysis of 1 mm-thick tissue slices enabled 3D-segmentation and quantification of astrocyte and neuron infection frequencies.Comparison of three highly virulent field virus clones from fox, dog, and raccoon with three lab-adapted strains revealed remarkable differences in the ability to infect astrocytes in vivo. While all viruses and infection routes led to neuron infection frequencies between 7-19%, striking differences appeared for astrocytes. Whereas astrocyte infection by field viruses was detected independent of the inoculation route (8-27%), only one lab-adapted strain infected astrocytes route-dependently [0% after intramuscular (i.m.) and 13% after intracerebral (i.c.) inoculation]. Two lab-adapted vaccine viruses lacked astrocyte infection altogether (0%, i.c. and i.m.). This suggests a model in which the ability to establish productive astrocyte infection in vivo functionally distinguishes field and attenuated lab RABV strains.Cells 2020, 9, 412 2 of 20 M [4-10], and neuronal survival regulation by G [11][12][13][14]. Most pathogenicity studies, however, were performed on already attenuated virus backbones. Thus, differences in their ability to cause disease between highly virulent field virus isolates and lab-adapted, less pathogenic RABV strains are poorly understood. Moreover, it is unclear how molecular differences identified in virulent and attenuated viruses affect virus replication and spread in the infected animal and how the complex virus-host interplay eventually results in either disease or an abortive infection.In vivo, after infection of neurons, RABV spreads trans-synaptically from infected to connected neurons [15]. Retrograde axonal transport of RABV over long distances [16,17] along microtubules [18,19] is a key step in RABV neuroinvasion and is essential for infection of the central nervous system (CNS) through the peripheral nervous system. Co-internalization together with the neuronal p75NTR (tumor necrosis factor receptor superfamily member 16; TNFRSF16) receptor, subsequent retrograde axonal transport of RABV particles in endocytic vesicles, and post-replicative anterograde axonal transport of newly formed RABV have been visualized by live virus particle tracking in sensory neurons [20,21], emphasizing the capacity of hijacking neuron-specific machineries for long distance transport to synaptic membranes. However, internalization and axonal transport of lab-adapted viruses [20,21] together with the use of vaccine virus vectors for trans-syn...

show abstract

Section: Virusesmentioning

confidence: 99%

Section: Virusesmentioning

confidence: 99%

Section: Virusesmentioning

confidence: 99%

Section: Archived Mouse Brains Infected With Rrabv Dog and Rrabv Foxmentioning

confidence: 99%

Section: Astrocyte Infection By Rabv Depends On the Type Of Virus (Fimentioning

confidence: 99%

See 3 more Smart Citations

Astrocyte Infection during Rabies Encephalitis Depends on the Virus Strain and Infection Route as Demonstrated by Novel Quantitative 3D Analysis of Cell Tropism

Potratz

Zaeck

Christen

et al. 2020

Cells

Self Cite

View full text Add to dashboard Cite

show abstract

Rapid Reverse Genetics Systems for Rhabdoviruses: From Forward to Reverse and Back Again

Nolden¹,

Finke²

2017

Methods in Molecular Biology

View full text Add to dashboard Cite

Methods to recover recombinant negative strand RNA viruses (rNSVs) from cloned cDNAs have been significantly improved in more than two decades of NSV reverse genetics . In particular, for non-segmented negative strand RNA viruses (NNSVs ) like rhabdoviruses , time-consuming generation of reverse genetics systems by stitching PCR subfragments of genomic rhabdovirus cDNAs using ligase-based conventional cloning approaches limited the number of available recombinant virus cDNA clones. As genetic variability is considered an intrinsic feature of RNA viruses, it is thus reasonable to conclude that reverse genetics approaches to investigate natural virus functions and pathogenesis require improved systems that reflect the complexity of naturally occurring wild-type viruses, and that largely exclude adaption to cell culture conditions.In order to allow rapid cloning of wild-type NSV genome populations into reverse genetics vector plasmids, we developed a system in which cDNA copies of complete rhabdovirus populations are inserted into a plasmid bank by linear-to-linear homologous RecE/T recombination (LLHR ). Limited requirements for sequence information a priori, high cloning efficiencies, and the possibility to directly generate recombinant viruses from individual cDNA clones now offer novel opportunities to combine forward genetic dissection of natural rhabdovirus populations and downstream reverse genetics approaches.

show abstract

New virus of the family Flaviviridae detected in lumpfish (Cyclopterus lumpus)

et al. 2017

View full text Add to dashboard Cite

In this study, we determined the complete coding sequence of a putative new member of the family Flaviviridae, named “Cyclopterus lumpus virus” (CLuV), which is associated with a serious disease in lumpfish (Cyclopterus lumpus). The virus was present in all tissues tested, but pathology was primarily observed in the liver and kidneys. CLuV shows low but distinct similarity to the unassigned Tamana bat virus (TABV). Unlike other known members of the family Flaviviridae, translation of the entire CLuV polyprotein is dependent on a − 1 ribosomal frameshift in the NS2A region.

show abstract

Reverse genetics in high throughput: rapid generation of complete negative strand RNA virus cDNA clones and recombinant viruses thereof

Cited by 24 publications

References 39 publications

Astrocyte Infection during Rabies Encephalitis Depends on the Virus Strain and Infection Route as Demonstrated by Novel Quantitative 3D Analysis of Cell Tropism

Astrocyte Infection during Rabies Encephalitis Depends on the Virus Strain and Infection Route as Demonstrated by Novel Quantitative 3D Analysis of Cell Tropism

Rapid Reverse Genetics Systems for Rhabdoviruses: From Forward to Reverse and Back Again

New virus of the family Flaviviridae detected in lumpfish (Cyclopterus lumpus)

Contact Info

Product

Resources

About