Rhizobium–legume symbiosis in the absence of Nod factors: two possible scenarios with or without the T3SS

Abstract

The occurrence of alternative Nod factor (NF)-independent symbiosis between legumes and rhizobia was first demonstrated in some Aeschynomene species that are nodulated by photosynthetic bradyrhizobia lacking the canonical nodABC genes. In this study, we revealed that a large diversity of non-photosynthetic bradyrhizobia, including B. elkanii, was also able to induce nodules on the NFindependent Aeschynomene species, A. indica. Using cytological analysis of the nodules and the nitrogenase enzyme activity as markers, a gradient in the symbiotic interaction between bradyrhizobial strains and A. indica could be distinguished. This ranged from strains that induced nodules that were only infected intercellularly to rhizobial strains that formed nodules in which the host cells were invaded intracellularly and that displayed a weak nitrogenase activity. In all nonphotosynthetic bradyrhizobia, the type III secretion system (T3SS) appears required to trigger nodule organogenesis. In contrast, genome sequence analysis revealed that apart from a few exceptions, like the Bradyrhizobium ORS285 strain, photosynthetic bradyrhizobia strains lack a T3SS. Furthermore, analysis of the symbiotic properties of an ORS285 T3SS mutant revealed that the T3SS could have a positive or negative role for the interaction with NF-dependent Aeschynomene species, but that it is dispensable for the interaction with all NF-independent Aeschynomene species tested. Taken together, these data indicate that two NF-independent symbiotic processes are possible between legumes and rhizobia: one dependent on a T3SS and one using a so far unknown mechanism.

Transcriptomic dissection of Bradyrhizobium sp. strain ORS285 in symbiosis with Aeschynomene spp. inducing different bacteroid morphotypes with contrasted symbiotic efficiency

“…None of them showed an upregulation in bacteroids, suggesting that contrary to other rhizobia, the symbiosis island of strain ORS285 has only a function at early stages of nodulation for Nod factor production encoded by the nodulation genes (Nouwen et al ., ). In addition, the T3SS of the symbiosis island in ORS285 does not seem to have a role in bacteroids, in agreement with a previously reported mutant analysis (Okazaki et al ., ).…”

Population genomics of the symbiotic plasmids of sympatric nitrogen‐fixing Rhizobium species associated with Phaseolus vulgaris

“…One possibility is that such variation might allow coadaptation to different host‐plant genotypes (Guttman et al ., ; McCann and Guttman, ; Nystedt et al ., ). Mutations in the T3SS region of the Sym plasmid of Rhizobium species NGR234 affect symbiosis with particular host plants species, while others remain unaffected (Viprey et al ., ); the same effect occurs in Mesorhizobium and Bradyrhizobium species, where T3SSs have shown to exert positive and negative effects on nodulation in some host plant species (Fauvart and Michiels, ; Okazaki et al ., ). Jorrin and Imperial () used Pool‐Seq methodology to discover plant‐specific single nucleotide polymorphisms (SNPs) patterns in the nod region of R. leguminosarum strains isolated from vetch, lentil, fava bean, or pea plants.…”

Symbiotic properties of a chimeric Nod‐independent photosynthetic Bradyrhizobium strain obtained by conjugative transfer of a symbiotic plasmid

“…To enable the selection of a chimeric ORS278 strain harbouring the pDOA9 plasmid, we first incorporated the non‐replicative plasmid pK18mob‐sacB carrying the Cefo resistance gene (pK18mob‐sacB‐Cefo r ) into an intergenic region of pDOA9 (between BRADOA9_v1_p0807 and BRADOA9_v1_p0808 genes) resulting in the plasmid annotated pDOA9*. For this purpose, the npt2‐Cefo containing region from pVO155‐npt2‐Cefo r plasmid (Okazaki et al ., ) was isolated after HindIII digestion and subsequently cloned into the HindIII site present in pK18mob‐sacB resulting in pK18mob‐sacB‐Cefo r . The intergenic region of pDOA9 was then amplified by PCR using the primers: Inter.DOA9p.f (5′‐CAGAAGGATCCCTCGAAGGCATCGCTGCCCAAAC‐′3) and Inter.DOA9p.r (5′ AGAGGGTCGACCTTGACAGGGCCGGGTTGATAC‐′3).…”

“…For the mutation of nodB (chitin deacetylase) and rhcN (ATPase of T3SS) present in pDOA9, an internal fragment (287 bp) of nodB and (263 bp) of rhcN were amplified by PCR using the following primers: nodB.D9p.int.f (5′‐TGACTCGTCGACGACGCCGCACCTCTTGGATGTTTTAG‐′3), nodB.D9p.int.r (5′‐GTTCCGTCTAGAGCCCATAGGGCGCACGTATATG‐′3), RhcN.D9p.int.f (5′‐CATCTCGTCGACTCGCAGCAAAGGATGTCGATAC‐′3) and RhcN.D9p.int.r (5′‐GAGCAGTCTAGACCCGACTGACACTTCCTGCATG‐′3). The PCR products were then ligated into the plasmid pVO155‐npt2‐Cefo‐npt2‐gfp (Okazaki et al ., ) at the Xbal and SalI restriction sites.…”

“…It is noteworthy that the mutation of nodB aborts the nodulation on A. afraspera but not on A. indica and A. evenia (Bonaldi et al ., ; Giraud et al ., ). Furthermore, the inactivation of the T3SS has an impact on NF‐dependent symbiosis but not on NF‐independent symbiosis (Okazaki et al ., ).…”