Rock1 & 2 Perform Overlapping and Unique Roles in Angiogenesis and Angiosarcoma Tumor Progression

Abstract

Abstract:The serine/threonine protein kinase paralogs ROCK1 & 2 have been implicated as essential modulators of angiogenesis; however their paralog-specific roles in endothelial function are unknown. shRNA knockdown of ROCK1 or 2 in endothelial cells resulted in a significant disruption of in vitro capillary network formation, cell polarization, and cell migration compared to cells harboring non-targeting control shRNA plasmids. Knockdowns led to alterations in cytoskeletal dynamics due to ROCK1 & 2-mediated reductions in actin isoform expression, and ROCK2-specific reduction in myosin phosphatase and cofilin phosphorylation. Knockdowns enhanced cell survival and led to ROCK1 & 2-mediated reduction in caspase 6 and 9 cleavage, and a ROCK2-specific reduction in caspase 3 cleavage. Microarray analysis of ROCK knockdown lines revealed overlapping and unique control of global transcription by the paralogs, and a reduction in the transcriptional regulation of just under 50% of VEGF responsive genes. Finally, paralog knockdown in xenograft angiosarcoma tumors resulted in a significant reduction in tumor formation. Our data reveals that ROCK1 & 2 exhibit overlapping and unique roles in normal and dysfunctional endothelial cells, that alterations in cytoskeletal dynamics are capable of overriding mitogen activated transcription, and that therapeutic targeting of ROCK signaling may have profound impacts for targeting angiogenesis.

Selective inhibition of brain endothelial Rho-kinase-2 provides optimal protection of an in vitro blood-brain barrier from tissue-type plasminogen activator and plasmin

“…For example, elevated levels of phosphorylated myosin were detected in the ischaemic brain vessel wall [13, 46], indicative of universal vascular ROCK activity in these conditions; further, it is now well-accepted that the RhoA/ROCK pathway inversely regulates endothelial nitric oxide synthase (eNOS) and that the beneficial activity of ROCK inhibitors is largely mediated via upregulation and activation of eNOS [47], also shown in the brain during stroke [16, 41]; finally, in isolated BECs nonselective ROCK inhibition attenuated OGD-invoked oxidative stress [14], tight junction degradation [48, 49], barrier dysfunction [48–50] and rt-PA-induced cell death and MMP-9 upregulation [22], indicative of substantial participation of ROCKs in the ischaemic BEC response. A more specific ROCK-2 expression and/or function has been documented in endothelial cells of the umbilical cord [31, 36], lung [31, 33, 40], pancreas [32, 34] and recently in brain arterioles [45], where it plays distinct roles in proinflammatory cell adhesion molecule expression [36], maintenance and regulation of vascular permeability [31] and vascular tone [45], temporal MLC phosphorylation [33] and angiogenesis [32, 34]. Taken together, it could be speculated that ROCK-2 is most likely involved in regulation of the cerebral microcirculation which forms the BBB, particularly during pathological processes.…”

Down-regulation of common NFκB-iNOS pathway by chronic Thalidomide treatment improves Hepatopulmonary Syndrome and Muscle Wasting in rats with Biliary Cirrhosis

“…Two isoforms of ROCK including ROCK1 and ROCK2 with highly homologous have been described33. Increased expression of ROCK1 in endothelial cell migration pathways can cause an increase in angiogenisis3435. There is a reciprocal positive regulating loop between apoptosis protein and ROCK expression33.…”

Rho kinase proteins display aberrant upregulation in vascular tumors and contribute to vascular tumor growth

“…shRNA vectors (SABiosciences) were transfected using Lipofectamine 2000 and cell pools were stably selected using puromycin. The sequences and efficacy of each shRNA and scrambled control vector used in this study have been previously validated by our lab and published [39] (scrambled control: GGAATCTCTCATTCGATGCATAC; ROCK1 shRNA: GCGCAATTGGTAGAAGAATGT; ROCK2 shRNA: AACCAACTGTGAGGCATGTAT). Y-27632 (trans-4-[(1R)-1-aminoethyl]-N-4-pyridinyl-cyclohexanecarboxamide; Santa Cruz Biotechnology) was utilized at 10 μM.…”

“…Our lab has previously used a combination of silencing RNA (shRNA)-mediated gene expression knockdown and a haplo-insufficient animal model to demonstrate that ROCK1 and 2 play unique and overlapping roles in regulating multiple aspects of endothelial function and angiogenesis, with ROCK2 acting as the dominant paralog in normal endothelial cells [39, 42, 59]. More investigations on the individual functions of the ROCK paralogs are needed to elucidate their underlying mechanisms and to determine the predominant paralog in normal and diseased tissues.…”