Role of CD40-CD40L in Mouse Severe Malaria

Abstract

We explored the role of CD40-CD40L (CD154) in the severe malaria elicited by Plasmodium berghei anka infection in mice. Mortality was >90% by day 8 after infection in ؉/؉ mice, but markedly decreased in CD40؊/؊ or in CD40L؊/؊ mice, as well as in ؉/؉ mice treated with anti-CD40L monoclonal antibody. Parasitemia was similar in the different conditions. Breakdown of the blood-brain barrier was evident in infected ؉/؉, but not in CD40؊/؊ mice. Thrombocytopenia was less severe in CD40؊/؊ mice than in the ؉/؉ controls. Sequestration of macrophages in brain venules and alveolar capillaries was reduced in CD40؊/؊ or in CD40L؊/؊ mice, whereas sequestration of parasitized red blood cells or polymorphonuclear leukocytes in alveolar capillaries was CD40-CD40L-independent. CD40 mRNA was increased in the brain and lung of infected mice whereas CD40L was increased in the lung. Tumor necrosis factor plasma levels were similarly increased in infected ؉/؉ or CD40؊/؊ mice. Expression of CD54 and its mRNA levels in the brain were moderately decreased in CD40-deficient mice. Thus the mortality associated with severe malaria requires CD40-CD40L interaction that contributes to the breakdown of the blood-brain barrier, macrophage sequestration, and platelet consumption.

Development of a Novel CD4+ TCR Transgenic Line That Reveals a Dominant Role for CD8+ Dendritic Cells and CD40 Signaling in the Generation of Helper and CTL Responses to Blood-Stage Malaria

“…Interestingly, CD40 signaling was not absolutely essential for ECM development, as CD40L-deficient mice eventually developed ECM in the absence of added PbT-II T cells, although with a delayed kinetics. This contrasts a previous report that found CD40L-deficient mice were resistant to ECM (94), an observation that may be explained by differences in animal housing facilities, potentially microbiota, known to affect ECM (95). In summary, our work extends earlier findings by determining that CD4 + T cell help is required for optimal CD8 + T cell expansion after infection with different doses of parasites, and is relatively independent of the initial CD8 + T cell precursor frequency.…”

Development of a Novel CD4+TCR Transgenic Line that Reveals a Dominant Role for CD8+DC and CD40-Signaling in the Generation of Helper and CTL Responses to Blood Stage Malaria

“…3, 2017; expressed by D78. This line has been termed PbT-II, consistent with our nomenclature for 1 MHC I and II restricted OVA-specific lines OT-I and OT-II and our recently reported MHC 2 I-restricted PbA-specific line specific, termed PbT-I (16). Analysis of the spleen and 3 inguinal lymph node (iLN) of PbT-II mice revealed skewing towards CD4 + T cells as well 4 as efficient expression of the Va2 and Vb12 transgenes derived from D78 (Fig 2 and S1D).…”

“…16 Transgenic T cell lines were crossed to mice expressing GFP ubiquitously (uGFP) or with 17 CD45.1 (Ly5.1) mice to allow for the differentiation of these cells from endogenous T cells 18 after adoptive transfer into recipient Ly5.2 B6 mice. XCR1-DTRvenus and CD11cDTR 19 Victoria, Australia) and maintained at the School of Botany, The University of Melbourne, 1…”

“…Sequencing analysis revealed that the TCR b-chain consisted of Vβ12, Dβ2 16 and Jβ2.4. The TCR β-chain VDJ segment was amplified by PCR from the genomic DNA 17 of the D78 hybridoma using the forward primer GGATCGATCACACTTGTTTTCCGTG 18 sorted into (MHC II hi CD11c hi ) CD8 + CD4 -(CD8 DC), CD8 -CD4 + (CD4 DC) For in vitro stimulation assays, DC (5 x 10 4 per well) were cultured for 1h with 7 titrated amounts of lysed whole blood containing mixed stages of PbA parasites before 8 adding 5 x 10 4 D78 or PbA-specific MHC I-restricted B4 hybridoma cells [16]. For ex vivo 9 experiments, DC were extracted from the spleens of PbA infected mice on day 3 after 10 infection with 10 6 iRBC.…”

“…2x10 5 to stimulate a PbA-specific MHC I-restricted hybridoma (16), showing these DC were 13 functional (Fig S1A). Furthermore, D78 responded efficiently to PbA iRBC lysate, but 14 failed to respond to DC activated by non-specific stimuli such as LPS, polyI:C or CpG, 15 thus excluding self-reactivity or reactivity to foetal calf serum proteins (Fig S1B).…”