Role of STAT-3 in regulation of hepatic gluconeogenic genes and carbohydrate metabolism in vivo

Abstract

The transcription factor, signal transducer and activator of transcription-3 (STAT-3) contributes to various physiological processes. Here we show that mice with liver-specific deficiency in STAT-3, achieved using the Cre-loxP system, show insulin resistance associated with increased hepatic expression of gluconeogenic genes. Restoration of hepatic STAT-3 expression in these mice, using adenovirus-mediated gene transfer, corrected the metabolic abnormalities and the alterations in hepatic expression of gluconeogenic genes. Overexpression of STAT-3 in cultured hepatocytes inhibited gluconeogenic gene expression independently of peroxisome proliferator-activated receptor-gamma coactivator-1 alpha (PGC-1 alpha), an upstream regulator of gluconeogenic genes. Liver-specific expression of a constitutively active form of STAT-3, achieved by infection with an adenovirus vector, markedly reduced blood glucose, plasma insulin concentrations and hepatic gluconeogenic gene expression in diabetic mice. Hepatic STAT-3 signaling is thus essential for normal glucose homeostasis and may provide new therapeutic targets for diabetes mellitus.

STAT3 Sensitizes Insulin Signaling by Negatively Regulating Glycogen Synthase Kinase-3β

“…In the nuclear translocation assay, low level of tyrosine phosphorylated STAT3 was observed in the nuclei but was independent of insulin ( Fig. 3), which was consistent with a previous study (18). On the other hand, an early nuclear translocation of serine phosphorylated STAT3 was observed (Fig.…”

“…cDNA was amplified by PCR with a iQ SYBR Green Supermix kit (Bio-Rad). The primers are GSK-3␤ (NM_019827, forward, 5Ј-CACTCAAGAACTGTCAAGTAAC-3Ј, and reverse, 5Ј-CATTAGTATCTGAGG CTGCTG-3Ј) located at the two joints of the last three exons; PEPCK (forward, GTGTCATCCGCAAGCTGAAG, and backward, CTTTCGATCCTGG CCACATC) (27); glucose-6-phosphatose (G6Pase) (forward, CTGCAAGG GAGAACTCAGCAA, and backward, GAGGACCAAGGAAGCCACAAT) (27); and peroxisome proliferator-activated receptor-␥ coactivator (PGC-1␣) (forward, 5Ј-ATACCGCAAAGAGCACGAGAAG-3Ј, and backward, 5Ј-CTCAAGAG CAGCGAAAGCGTCACAG-3Ј) (18). PCR conditions are as follows: one cycle of 94°C for 2 min; 35 cycles of 94°C for 30 s, 55°C for 30 s, and 72°C for 45 s; followed by one cycle of 72°C for 10 min.…”

“…Recently, other investigators and our group have succeeded in removing STAT3 from individual tissue by the Cre/LoxP method (16), which circumvents the problem of embryonic lethality and has demonstrated roles for STAT3 in a wide variety of tissues (17). Interestingly, liver-specific ablation of STAT3 led to an increase in hepatic gluconeogenic genes and insulin resistance, which was attributed to the disruption of interleukin-6 (IL6) signaling either directly (18) or through a brain-mediated release of IL6 from the liver (19). However, the role of STAT3 in insulin signaling per se is still not clear.…”

Interleukin-18 resistance in patients with obesity and type 2 diabetes mellitus

“…However, additional mechanisms of IL-18 resistance may very well be involved, including defective activation of its receptor pathways. In this respect, it is relevant to mention that one of the intracellular pathways activated by IL-18R, STAT3 phosphorylation, is also crucial for the insulin and leptin resistance, 31 and, as we have shown, responsible for the obesity and insulin resistance in IL-18À/À mice. 32 This also explains the selective deficiency of IFNg production in obese and diabetes subjects upon stimulation with IL-18: the induction of IFNg by IL-18 involves mitogen-activated protein kinase 33 and signal transducer and activator of transcription 3 (STAT-3), 34 whereas production of TNF and IL-6 are nuclear factor-kB-mediated events.…”

Cell Type–Dependent Pro- and Anti-Inflammatory Role of Signal Transducer and Activator of Transcription 3 in Alcoholic Liver Injury

“…17 Activation of STAT3 in hepatocytes has been reported in virtually all models of liver injury 17 and has been shown to contribute to acute phase responses, 19 liver regeneration, 20, 21 amelioration of liver injury, 22-24 regulation of gluconeogenesis and carbohydrate metabolism. 25 Activation of STAT3 has also been reported in chronic human alcoholic hepatitis and alcoholic cirrhosis. 26, 27 However, the role of STAT3 in alcoholic liver disease remains elusive.…”