2003
DOI: 10.1002/chin.200351093
|View full text |Cite
|
Sign up to set email alerts
|

(S,S)‐2,3‐Dihydroxy‐2,3‐dihydrobenzoic Acid: Microbial Access with Engineered Cells of Escherichia coli and Application as Starting Material in Natural‐Product Synthesis.

Abstract: Carboxylic acidsCarboxylic acids Q 0420 (S,S)-2,3-Dihydroxy-2,3-dihydrobenzoic Acid: Microbial Access with Engineered Cells of Escherichia coli and Application as Starting Material in Natural-Product Synthesis. -An efficient microbial synthesis of the title acid (II) is reported using methods of deregulating the metabolic flux in E. coli strains. (II) can easily be transformed into the enantiomer(V) of the plant-growth inhibitor streptol. -(FRANKE, D.; LORBACH, V.; ESSER, S.; DOSE, C.; SPRENGER, G. A.; HALFAR,… Show more

Help me understand this report

Search citation statements

Order By: Relevance

Paper Sections

Select...
1
1
1
1

Citation Types

0
4
0

Year Published

2004
2004
2008
2008

Publication Types

Select...
3

Relationship

0
3

Authors

Journals

citations
Cited by 3 publications
(4 citation statements)
references
References 1 publication
0
4
0
Order By: Relevance
“…Empty vector pJF119EH1 and EntC-overexpressing construct pDF2 (Franke et al, 2003) were a kind gift from G. Sprenger (Stuttgart, Germany). ICS1 coding sequence without the first 45 amino acids was flanked with NcoI and BamHI restriction sites by amplification with primers ICS1-1 (AACTTTAA-GAAGGAGATATACCATGGCATATGCTATGTCTATGAATGGTTGTGAT) and ICS1-2 (GGATCCTCAATTAATCGCCTGTAGAGA) and was subcloned into the pGEM-T-Easy vector (Promega).…”
Section: Functional Complementation Of the Pbb8 Strain Of Escherichiamentioning
confidence: 99%
“…Empty vector pJF119EH1 and EntC-overexpressing construct pDF2 (Franke et al, 2003) were a kind gift from G. Sprenger (Stuttgart, Germany). ICS1 coding sequence without the first 45 amino acids was flanked with NcoI and BamHI restriction sites by amplification with primers ICS1-1 (AACTTTAA-GAAGGAGATATACCATGGCATATGCTATGTCTATGAATGGTTGTGAT) and ICS1-2 (GGATCCTCAATTAATCGCCTGTAGAGA) and was subcloned into the pGEM-T-Easy vector (Promega).…”
Section: Functional Complementation Of the Pbb8 Strain Of Escherichiamentioning
confidence: 99%
“…Isochorismatase activity was assayed as described by Rusnak et al. [1], by using chorismate acid as the alternative substrate [17], and nicotinamidase activity was measured as described by Anderson et al. [18], by using nicotinamide as the substrate.…”
Section: Methodsmentioning
confidence: 99%
“…As BbycaCR protein belongs to the isochorismatase superfamily and has structural similarities to some other enzymes of the superfamily, including isochorismatase, nicotinamidase and N-carbamoylsarcosine amidohydrolase [4,6], all three enzyme activities of the recombinant protein expressed in E. coli were tested. Isochorismatase activity was assayed as described by Rusnak et al [1], by using chorismate acid as the alternative substrate [17], and nicotinamidase activity was measured as described by Anderson et al [18], by using nicotinamide as the substrate. For N-carbamoylsarcosine amidohydrolase activity assay, the substrate N-carbamoylsarcosine was chemically synthesized with sarcosine and potassium cyanate by the method of Nyc & Mitchell [19], and the enzyme activity was detected as described by Zajc et al [20].…”
Section: Enzymatic Activity Assaysmentioning
confidence: 99%
“…Several production approaches have been published using, for instance, recombinant E. coli strains. Examples are the production of pathway intermediates such as 3-dehydroshikimic acid (Li et al, 1999), shikimic acid (Chandram et al, 2003), chorismate derivatives such as trans-2,3-cyclohexanediole (Franke et al, 2003a), or trans-3,4-cyclohexanediole (Franke et al, 2003b) and the final pathway products L-tryptophane, L-tyrosine, and L-phenylalanine (Bongaerts et al, 2001; Drauz et al, 2002;Gerigk et al, 2002). Among these products, L-phenylalanine currently represents the largest economical market with 11 000 to 12 000 tons per year and a product price of 20-40 US$/ kg depending on the product purity (Bongaerts et al, 2001).…”
Section: Introductionmentioning
confidence: 97%