S3440P Substitution in C-Terminal Region of Human Reelin Dramatically Impairs Secretion of Reelin from HEK 293T cells

Esmaeilzadeh-Gharehdaghi, Elika; Razmara, Ehsan; Bitaraf, Amirreza; Mahmoudi, Mahdi; Garshasbi, Masoud

doi:10.14715/cmb/2019.65.6.3

Cited by 8 publications

(8 citation statements)

References 33 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Co‐segregation analysis was investigated in the family. For this purpose, the primers were designed using Primer3.0 (http://bioinfo.ut.ee/primer3-0.4.0) 14 and the polymerase chain reaction (PCR) was performed under standard conditions 15 using the primers: forward, 5′‐TGGGACGAGGAAAGGGGTAT‐3′ and reverse, 5′‐AATGAGGCTGAGTGCTGGTC‐3′. The PCR product (522 bp) was sequenced on an ABI 3500xL DNA Analyzer (Applied Biosystems, Foster City, CA, USA) and the product sequences were analyzed using CodonCode aligner, version 6.0.2 (CodonCode Corp., Centerville, MA, USA).…”

Section: Methodsmentioning

confidence: 99%

A novel variant of ST3GAL3 causes non‐syndromic autosomal recessive intellectual disability in Iranian patients

Farajollahi

Razmara

Heidari

et al. 2020

The Journal of Gene Medicine

Self Cite

View full text Add to dashboard Cite

Background: The number of reported genes causing non-syndromic autosomal recessive intellectual disability (NS-ARID) is increasing. For example, mutations in the ST3GAL3 gene have been reported to be associated with NS-ARID. In the present study, we aimed to determine the genetic cause of the NS-ARID in a five-generation consanguineous Iranian family. Methods: We subjected four patients with an initial diagnosis of NS-ID in an Iranian family. To identify the possible genetic cause(s), whole-exome sequencing was performed on the proband and Sanger sequencing was applied to investigate cosegregation analysis. Using in silico predictive tools, the possible impacts of the variant on the structure and function of ST3Gal-III were predicted. Results: The common clinical features were detected in all affected members who were suffering from a severe ID. Using whole-exome sequencing, a novel variant, c.704C>T or p.(Thr235Met), in exon 9 of the ST3GAL3 gene (NM_001270461.2, OMIM# 606494) was identified and verified by Sanger sequencing. This variant is located next to the VS motif of ST3Gal-III, which is a vital part of the catalytical domains. Conclusions: In the present study, we identified a novel missense variant, c.704C>T or p.(Thr235Met), in the ST3GAL3. To our knowledge, is the third variant in this gene to be associated with NS-ARID. Our findings highlight the need for further investigations into the mechanisms by which variants in ST3GAL3 contribute to neurological dysfunction.

show abstract

Section: Methodsmentioning

confidence: 99%

A novel variant of ST3GAL3 causes non‐syndromic autosomal recessive intellectual disability in Iranian patients

Farajollahi

Razmara

Heidari

et al. 2020

The Journal of Gene Medicine

Self Cite

View full text Add to dashboard Cite

show abstract

“…b) Serial brain MRI without contrast of the patient with an interval of two months (MRI 1 and 2) shows progressive cerebral and cerebellar atrophy in T1-W (A-E, K-O) and their cognate T2-W images (F-J, P-S) in horizontal, sagittal, and coronal planes (compare A, B with K, M for cerebral and C, D with N, R for cerebellar atrophy). Besides, thin white arrows in FLIAR-MRI 1 and 2 exhibit progressive posterior deep white matter signal changes in two serial FLAIR sequences standard condition [14]. The PCR products were sequenced by ABI 3500xl DNA Analyzer (Applied Biosystems Co., Foster City, CA), using the conventional capillary system; sequences were analyzed by the Genome-Compiler online tool (Twist Bioscience, USA) and Mutation Surveyor (v.3.24, SoftGenetics) [15] to identify any alternations (Fig.…”

Section: Whole Exome and Sanger Sequencingmentioning

confidence: 98%

“…The primers were designed by Primer3.0 web-based server [ 13 ] to amplify the exon 4 of the ADPRHL2 gene as follows: Forward: 5́-TCTGTCTCCCCTTCTGTTCC-3́ and Reverse: 5́-AGGGTCTGCAATTGAGGAAG-3́. The polymerase chain reaction (PCR) was performed in a standard condition [ 14 ]. The PCR products were sequenced by ABI 3500xl DNA Analyzer (Applied Biosystems Co., Foster City, CA), using the conventional capillary system; sequences were analyzed by the GenomeCompiler online tool (Twist Bioscience, USA) and Mutation Surveyor (v.3.24, SoftGenetics) [ 15 ] to identify any alternations (Fig.…”

Section: Case Presentationmentioning

confidence: 99%

Novel imaging and clinical phenotypes of CONDSIAS disorder caused by a homozygous frameshift variant of ADPRHL2: a case report

et al. 2020

Self Cite

View full text Add to dashboard Cite

Background: Stress-induced childhood-onset neurodegeneration with variable ataxia and seizures (CONDSIAS) is an autosomal recessive disorder caused by defects in the ADP-Ribosylhydrolase Like 2 (ADPRHL2; OMIM: 618170) gene. This gene encodes the ADP-ribosylhydrolase enzyme (ARH3) that eliminates the addition of poly-ADP ribose (PAR) in the cellular stress onto proteins in the ADP-ribosylation process in which adding one or more ADP-ribose moieties onto the target proteins in the post-translational modification have occurred. In this study, we report a new case of CONDSIAS in the Iranian population. A literature review of CONDSIAS is also included. Case presentation: A four-year-old female patient, born to a consanguineous Iranian family, was referred with various clinical symptoms including impaired speech, variable ataxia, infrequent seizures, and gradual onset of truncal hypotonia. Over time, she developed complete motor and speech regression, bilateral sensorineural hearing loss, infrequent seizures, abdominal distension and gastrointestinal (GI) intolerance, and loss of consciousness. To better molecularly diagnose, trio-whole-exome sequencing (WES) was performed on the proband and her parents. Sanger sequencing was also applied to investigate co-segregation analysis. Using in silico predictive tools, the possible impacts of the variant on the structure and function of ADPRHL2 protein were predicted. All basic metabolic tests were normal, while serial coronal magnetic resonance imaging (MRI) showed progressive cerebral and cerebellar atrophy in addition to cerebral white matter signal changes as a novel neuroimaging finding. GI intolerance was another novelty of clinical scenarios in the patient. An auditory brainstem response test showed a severe bilateral sensorineural hearing loss. An electroencephalogram also confirmed focal seizures. From the molecular perspective, a novel homozygous frameshift variant in the ADPRHL2 gene (NM_017825.2; c.636_639del, p.(Leu212fs)) was identified by WES. Conclusions: CONDSIAS is an ultra-rare neurodegenerative disorder. In the present study, we introduced extraneurological and neuroimaging findings of this disorder in a female child caused by a novel frameshift variation in the ADPRHL2 gene.

show abstract

“…The primers specificity was checked by the in-silico-PCR tool in UCSC genome browser ( https://genome.ucsc.edu/cgi-bin/hgPcr ) and Primer blast of NCBI genome browser ( https://www.ncbi.nlm.nih.gov/tools/ primer-blast/). Consequently, polymerase chain reaction (PCR) was utilized in standard conditions [ 16 ] and the PCR products were sequenced on an ABI 3130 with the ABI PRISM BigDye Terminator v. 3.1 sequencing kit (Applied Biosystems, USA). The Sequences were analyzed using Genome Compiler online tool ( http://www.genomecompiler.com/ ) and Mutation Surveyor v.3.24 (SoftGenetics) to identify the alternations (Fig.…”

Section: Methodsmentioning

confidence: 99%

Neurodevelopmental disorder with microcephaly, hypotonia, and variable brain anomalies in a consanguineous Iranian family is associated with a homozygous start loss variant in the PRUNE1 gene

Gholizadeh

Mohammadi-Sarband²,

Fardanesh³

et al. 2022

BMC Med Genomics

Self Cite

View full text Add to dashboard Cite

Background Homozygous or compound heterozygous PRUNE1 mutations cause a neurodevelopmental disorder with microcephaly, hypotonia, and variable brain malformations (NMIHBA) (OMIM #617481). The PRUNE1 gene encodes a member of the phosphoesterase (DHH) protein superfamily that is involved in the regulation of cell migration. To date, most of the described mutations in the PRUNE1 gene are clustered in DHH domain. Methods We subjected 4 members (two affected and two healthy) of a consanguineous Iranian family in the study. The proband underwent whole-exome sequencing and a start loss identified variant was confirmed by Sanger sequencing. Co-segregation of the detected variant with the disease in family was confirmed. Results By whole-exome sequencing, we identified the a start loss variant, NM_021222.3:c.3G>A; p.(Met1?), in the PRUNE1 in two patients of a consanguineous Iranian family with spastic quadriplegic cerebral palsy (CP), hypotonia, developmental regression, and cerebellar atrophy. Sanger sequencing confirmed the segregation of the variant with the disease in the family. Protein structure analysis also revealed that the variant probably leads to the deletion of DHH (Asp-His-His) domain, the active site of the protein, and loss of PRUNE1 function. Conclusion We identified a start loss variant, NM_021222.3:c.3G>A; p.(Met1?) in the PRUNE1 gene in two affected members as a possible cause of NMIHBA in an Iranian family. We believe that the study adds a new pathogenic variant in spectrum of mutations in the PRUNE1 gene as a cause of PRUNE1-related syndrome.

show abstract

S3440P Substitution in C-Terminal Region of Human Reelin Dramatically Impairs Secretion of Reelin from HEK 293T cells

Cited by 8 publications

References 33 publications

A novel variant of ST3GAL3 causes non‐syndromic autosomal recessive intellectual disability in Iranian patients

A novel variant of ST3GAL3 causes non‐syndromic autosomal recessive intellectual disability in Iranian patients

Novel imaging and clinical phenotypes of CONDSIAS disorder caused by a homozygous frameshift variant of ADPRHL2: a case report

Neurodevelopmental disorder with microcephaly, hypotonia, and variable brain anomalies in a consanguineous Iranian family is associated with a homozygous start loss variant in the PRUNE1 gene

Contact Info

Product

Resources

About