Safety assessment of nonbrowning potatoes: opening the discussion about the relevance of substantial equivalence on next generation biotech crops

Abstract

SummaryIt is expected that the next generation of biotech crops displaying enhanced quality traits with benefits to both farmers and consumers will have a better acceptance than first generation biotech crops and will improve public perception of genetic engineering. This will only be true if they are proven to be as safe as traditionally bred crops. In contrast with the first generation of biotech crops where only a single trait is modified, the next generation of biotech crops will add a new level of complexity inherent to the mechanisms underlying their output traits. In this study, a comprehensive evaluation of the comparative safety approach on a qualityimproved biotech crop with metabolic modifications is presented. Three genetically engineered potato lines with silenced polyphenol oxidase (Ppo) transcripts and reduced tuber browning were characterized at both physiological and molecular levels and showed to be equivalent to wild-type (WT) plants when yield-associated traits and photosynthesis were evaluated. Analysis of the primary metabolism revealed several unintended metabolic modifications in the engineered tubers, providing evidence for potential compositional inequivalence between transgenic lines and WT controls. The silencing construct sequence was in silico analysed for potential allergenic cross-reactivity, and no similarities to known allergenic proteins were identified. Moreover, in vivo intake safety evaluation showed no adverse effects in physiological parameters. Taken together, these results provide the first evidence supporting that the safety of next generation biotech crops can be properly assessed following the current evaluation criterion, even if the transgenic and WT crops are not substantially equivalent.

A quantitative real-time PCR method for in planta monitoring of Phytophthora infestans growth

“…The EF‐1 α Fwd (5′‐TGAGGCAAACTGTTGCTGTC‐3′) and EF‐1 α Rev (5′‐TGGAAACACCAGCATCACAC‐3′) primers (Llorente et al. 2010) designed based on the sequence of the elongation factor 1‐α gene of S. tuberosum ( Ef‐1α ; GenBank accession number: ) were used to quantify S. tuberosum DNA.…”

GMOs in animal agriculture: time to consider both costs and benefits in regulatory evaluations

“…Whether this represents a safety concern will depend on the trait. One study explored the use of the current safety evaluation criteria on a quality-improved GE potato and concluded that the safety of the second generation crops can be properly assessed using the existing current comparative safety assessment methodology [108]. Standard protocols outlining best practices for the conduct of animal studies to evaluate crops genetically modified for output traits have been developed [102].…”

Physicochemical and biochemical characterization of transgenic papaya modified for protection against Papaya ringspot virus

“…transgenic lines should be shown to be substantially equivalent. While there is much controversy surrounding the role of substantial equivalence in biosafety evaluations, it is recommended for use in initial risk assessment of genetically modified food crops . Essentially, the transgenic crop is compared to its conventional counterpart in agronomic evaluations and compositional analyses to identify whether the acquisition of a new trait has led to unintended effects.…”