Scn2a Haploinsufficiency in Mice Suppresses Hippocampal Neuronal Excitability, Excitatory Synaptic Drive, and Long-Term Potentiation, and Spatial Learning and Memory

Abstract

Nav1.2, a voltage-gated sodium channel subunit encoded by the Scn2a gene, has been implicated in various brain disorders, including epilepsy, autism spectrum disorder, intellectual disability, and schizophrenia. Nav1.2 is known to regulate the generation of action potentials in the axon initial segment and their propagation along axonal pathways. Nav1.2 also regulates synaptic integration and plasticity by promoting back-propagation of action potentials to dendrites, but whether Nav1.2 deletion in mice affects neuronal excitability, synaptic transmission, synaptic plasticity, and/or disease-related animal behaviors remains largely unclear. Here, we report that mice heterozygous for the Scn2a gene ( Scn2a +/- mice) show decreased neuronal excitability and suppressed excitatory synaptic transmission in the presence of network activity in the hippocampus. In addition, Scn2a +/- mice show suppressed hippocampal long-term potentiation (LTP) in association with impaired spatial learning and memory, but show largely normal locomotor activity, anxiety-like behavior, social interaction, repetitive behavior, and whole-brain excitation. These results suggest that Nav1.2 regulates hippocampal neuronal excitability, excitatory synaptic drive, LTP, and spatial learning and memory in mice.

Characterization of a gene-trap knockout mouse model ofScn2aencoding voltage-gated sodium channel Nav1.2

“…A second Scn2a null mouse model was achieved by the deletion of exons 4-6 (MGI:6407391, Scn2a tm1.2Bcgen ), which was generated and studied by Dr. Kim's lab at the Korea Advanced Institute of Science and Technology (KAIST) in Daejeon, South Korea. Homozygous Scn2a knock-out in this mouse model also died perinatally [12], further illustrating that Scn2a null mice cannot be obtained for adult studies. Their phenotypic analysis of heterozygous mice supported the fact that most behaviors of Scn2a +/mice are relatively normal compared to WT (males only as well).…”

Genetic Landscape of Rett Syndrome Spectrum: Improvements and Challenges

“…For instance, young adult Mef2c and Scn2a cKO mice present a normal gross brain morphology and cortical layer organization, as murine RTT models. In contrast, Mef2c cKO mice cause an increase in dendritic spine density on dentate granule neurons of the hippocampal dentate gyrus [63] and Scn2a cOK in pre-oligodendrocyte alters their morphology, impairs myelination and reduces axon-oligodendrocyte interactions [64,65]. Moreover, depletion of specific presynaptic proteins involved in exocytosis, such as STXBP1 , causes abnormalities in neurotransmitter concentrations and produces neuronal cell death [66].…”

Splice‐dependent trans‐synaptic PTP δ– IL 1 RAPL 1 interaction regulates synapse formation and non‐ REM sleep

“…F1 heterozygous mice were obtained, after which subsequent generations were bred with C57BL/6J mice for at least 4 generations to ensure background purity. Whole‐body meA deletion ( Ptprd‐meA −/− ) mice were obtained by first injection of purified hexa‐histidine‐TAT‐NLS‐Cre (HTNC) enzyme into the two‐cell LoxP‐target‐LoxP (floxed) allele heterozygous embryo as a one‐step method of acquiring Ptprd‐meA +/− mice, removing the need to outbreed genetically coded Cre (Shin et al , ).The resulting Ptprd‐meA +/− mice were mated in Ptprd‐meA +/− × Ptprd‐meA +/− fashion to obtain Ptprd‐meA +/+ and Ptprd‐meA −/− mice. For genotype the floxed and Ptprd‐meA −/− mice, following primers were used: meA_Forward [TGTCTTAAAAGTCAAAGAATGACTCCCC], meA_Reverse [ATCACTGCTCGAGGACCTCTGGATA], and meA_Mut [GGCCCACACAGTAGCTGTGGCAATA].…”