Selective Biodegradation of S and N Heterocycles by a Recombinant Rhodococcus erythropolis Strain Containing Carbazole Dioxygenase

Abstract

The carbazole dioxygenase genes were introduced into a dibenzothiophene degrader. The recombinant Rhodococcus erythropolis SN8 was capable of efficiently degrading dibenzothiophene and carbazole simultaneously. SN8 could also degrade various alkylated derivatives of carbazole and dibenzothiophene in FS4800 crude oil by just a one-step bioprocess.Acid precipitation resulting from fossil fuel combustion has driven enormous efforts to remove contaminants from fossil fuels. Heteroatoms such as nitrogen and sulfur in crude oil can also poison the catalysts used in catalytic cracking and hydrotreating processes (6). Microorganisms possess the capability to metabolize sulfur-and nitrogen-containing compounds in crude oil (18). Dibenzothiophene (DBT) has been used as a model sulfur compound, and research has been focused on strains that can selectively remove sulfur by a 4S pathway, in which DBT is converted to 2-hydroxybiphenyl (2-HBP) (5,8,12,14,15). Carbazole (CA) is the most abundant nitrogencontaining compound in many petroleum samples and was therefore chosen as a model compound (7). A variety of CAdegrading microorganisms have been reported (9,10,17,21,22). These different CA degraders follow similar degradation pathways, and the first step is catalysis by CA dioxygenase, which converts CA to 2Ј-aminobiphenyl-2, 3-diol (18, 20).Unlike biodesulfurization, where sulfur is selectively removed from substrates, leaving the hydrocarbon portion of the molecule intact, the pathway of CA degradation only liberates nitrogen in the course of completely degrading the substrates (1). Mutants or recombinants capable of carrying out only the first step(s) of the CA degradation pathway could be used to avoid the loss of fuel value. Since the nitrogen compounds in petroleum refinery feed stocks are known to poison catalysts, the microbial products from CA degradation might be expected to cause less catalyst inhibition than their parent compounds (18). Therefore, there is much hope that the efficiency of conventional catalytic processing of crude oil can be improved by microbial modification of nitrogenous catalyst poisons. Blocked mutants also have the ability to preserve the carbon content of the fuel being treated, retaining the fuel value. However, there have been no reports concerning host engineering to investigate the partial transformation pathway of CA in crude oil as a possible alternative to its total removal.In this study, a CA dioxygenase gene was introduced into the excellent DBT degrader Rhodococcus erythropolis XP (24), which could desulfurize DBT via a 4S pathway. The resultant recombinant was designated SN8. Based on the DNA sequence of Pseudomonas sp. strain CA10 (20), the primers used were as follows: Primer1, 5Ј-GCCGACTAGTAAGGAGATGGACGT GGCG-3Ј (SpeI restriction site underlined); Primer2, 5Ј-CAT GCAAATTTCCTTCTAGTTCCTTCAGCCCGAAACGTGC GCTT-3Ј; Primer3, 5Ј-AAGCGCACGTTTCGGGCTGAAGG AACTAGAAGGAAATTTGCATG-3Ј; Primer4, 5Ј-GACGAG TACTGCAGCGCCGTCATACGTTGC-3Ј (ScaI site underlined). The underlined bases in Primer2 matche...

Simultaneous Biodetoxification of S, N, and O Pollutants by Engineering of a Carbazole-Degrading Gene Cassette in a Recombinant Biocatalyst

“…1). The DBT transformation rate was equivalent to that of the host strain R. erythropolis XP and the previously described recombinant strain SN8 containing carbazole dioxygenase (38). These results also indicated that the introduced CA-degrading enzymes had no significant effect on the DBT biotransformation rate.…”

Characterization of a Novel Rieske-Type Alkane Monooxygenase System in Pusillimonas sp. Strain T7-7

“…strain HR199 and CarAa from Pseudomonas sp. strain XLDN4-9 (37,38). Other research also showed that ␣ subunit alone can control substrate specificity in dioxygenases of the naphthalene family (39,40) and toluene/biphenyl family (41,42).…”

Complete genome sequence of Mycobacterium goodii X7B, a facultative thermophilic biodesulfurizing bacterium with industrial potential

“…On the other hand, biocatalytic processes were cheaper, operated under milder conditions, and had higher selectivity. There have been numerous efforts to develop a biotechnological process for biodesulfurization of fossil fuels using specific isolated strains (Yu et al, 2006b;Yu et al, 2006c). A small number of mesophilic genera, Arthrobacter, Bacillus, Corynebacterium, and Rhodococcus, are known to be able to remove sulfur from dibenzothiophene (DBT), the model sulfur compound in petroleum, via a sulfur-specific manner without affecting the carbon skeleton thus the calorific value of the fuel value remains preserved (Xu et al, 2006).…”