Sensitive Marker of the Cisplatin-DNA Interaction: X-Ray Photoelectron Spectroscopy of CL

Abstract

The development of cisplatin and Pt-based analogues anticancer agents requires knowledge concerning the molecular mechanisms of interaction between such drugs with DNA. However, the binding dynamics and kinetics of cisplatin reactions with DNA determined by traditional approaches are far from satisfactory. In this study, a typical 20-base oligonucleotide (CGTGACAGTTATTGCAGGCG), as a simplified model representing DNA, was mixed with cisplatin in different molar ratios and incubation time. High-resolution XPS spectra of the core elements C, N, O, P, and Cl were recorded to explore the interaction between cisplatin and DNA. From deconvoluted Cl spectra we could readily differentiate the covalently bound chlorine from ionic chloride species in the cisplatin-oligo complexes, which displayed distinct features at various reaction times and ratios. Monitoring the magnitude and energy of the photoelectron Cl 2p signal by XPS could act as a sensitive marker to probe the interaction dynamics of chemical bonds in the reaction of cisplatin with DNA. At 37°C, the optimum incubation time to obtain a stable cisplatin-oligo complex lies around 20 hrs. This novel analysis technique could have valuable implications to understand the fundamental mechanism of cisplatin cytotoxicity and determine the efficiency of the bonds in treated cancer cells.

Cleavage Enhancement of Specific Chemical Bonds in DNA by Cisplatin Radiosensitization

“…In this manner, the relative amount of each element can be estimated within the probing depth. The XPS characterization of these bonds for DNA and cisplatin–DNA complexes have been reported previously . The same assignments relating to the four principal elements apply to the present study.…”

“…It has been shown that the introduction of cisplatin generally induces substantial positive BE shifts of DNA elements compared to that of pure DNA. 30 Consistently, before irradiation for N 1s, the amino and imino species of cisplatin−DNA complexes shift to higher BE of 0.5 ± 0.1 and 0.7 ± 0.1 eV, respectively, compared to that of DNA. Figure 3c illustrates that C−OH (O-1) and carbonyl group (O-2) show positive BE shifts of 0.4 ± 0.1 and 0.9 ± 0.1 eV with the addition of cisplatin, while the O-3 exhibits no substantial BE shift.…”

“…The XPS characterization of these bonds for DNA 26 and cisplatin− DNA complexes have been reported previously. 30 The same assignments relating to the four principal elements apply to the present study. For clarity, the deconvoluted peaks are only noted in the spectra of postirradiation (Figure 1).…”

Supercritical CO2 Processing Generates Aqueous Cisplatin Solutions with Enhanced Cancer Specificity

“…The precise binding energy locations were identified by deconvolution of the experimental curve at 197.4 and 198.3 eV, respectively. The presence of sharp bands in the high-resolution spectra at Cl 2p 1/2 is attributed to chloride ion from solubilized cisplatin in water . Overall, it appears that the RESS-processed cisplatin seemed to (mostly) retain its chemical and structural identity.…”

“…The presence of sharp bands in the high-resolution spectra at Cl 2p 1/2 is attributed to chloride ion from solubilized cisplatin in water. 37 Overall, it appears that the RESS-processed cisplatin seemed to (mostly) retain its chemical and structural identity. In principle, these characterizations are expected to serve as a benchmark for our future cisplatin optimization studies.…”