Sequencing and analysis of the complete mitochondrial genome of Amur minnow from China

Abstract

The complete mitogenome sequence of Amur minnow (Rhynchocypris lagowskii) was determined using long PCR. The genome was 16,594 bp in length and contained 13 protein-coding genes, two ribosomal RNA genes, 22 transfer RNA genes, and one control region. The overall base composition of the heavy strand is A (28.60%), C (26.32%), T (27.40%), and G (17.68%). The control region was 927 bp in length and the A + T content of the region was 63.32%. The extended termination-associated sequence domain, the central conserved domain, and the conserved sequence block domain are defined in the mitochondrial genome control region of Amur minnow. Mitochondrial genomes analyses based on maximum parsimony (MP), neighbor-joining (NJ), and Bayesian analyses yielded identical phylogenetic trees, indicating a close phylogenetic affinity of the 15 Cyprinidae species. It appeared that no less than two major phyletic lineages were present in Leuciscinae. The main clades within the Leuciscinae supported are: A clade is the Tribolodon. A clade (Rhynchocypris) with the Oreoleuciscus as the sister taxon to Tribolodon was supported by bootstrap values of 49%. The five different geographical populations of the R. lagowskii formed a paraphyletic group with the high bootstrap value (45%) in all examinations.

The phylogeographical pattern of the Amur minnow Rhynchocypris lagowskii (Cypriniformes: Cyprinidae) in the Qinling Mountains

“…lagowskii was extracted from each specimen following the operation instruction of the TIANamp Marine Animals DNA Kit (Tiangen Biotech, Beijing, China). The forward primer Cytb‐F (5’‐ATGGCAAGCCTACGAAAAAC‐3’) and the reverse primer Cytb‐R (5’‐GATTACAAGACCGATGCTTT‐3’) designed based on the same species (Zhao et al, 2016) were used to amplify a 540‐bp fragment of the mitochondrial cytochrome b ( Cytb ) gene by polymerase chain reaction (PCR) for each specimen. PCR amplification was performed in a total volume of 25 µL, containing 3 mM MgCl 2 , 10 mM Tris‐HCl (pH 8.3), 50 mM KCl, 0.25 mM of each dNTP, 1.25 U rTaq polymerase (TaKaRa, Dalian, China), 0.4 μM of each primer, 45 ng gDNA, tapped with Milli‐Q water.…”

“…Total genomic DNA of R. lagowskii was extracted from each specimen following the operation instruction of the TIANamp Marine Animals DNA Kit (Tiangen Biotech, Beijing, China). The forward primer Cytb-F (5'-ATGGCAAGCCTACGAAAAAC-3') and the reverse primer Cytb-R (5'-GATTACAAGACCGATGCTTT-3') designed based on the same species (Zhao et al, 2016) ing cycling conditions were applied: initial denaturation for 1 min at 93°C followed by 35 cycles of denaturation for 10 s at 92°C, annealing for 1.5 min at 51°C, and extension for 2 min at 60°C with a final extension for 6 min at 72°C (Chen et al, 2020). All fragments were initially purified with a PCR purification kit (BGI Biotech, Shenzhen, China), subsequently subjected to electrophoresis in a 1% agarose gel, and finally sequenced with the forward primer using an ABI Prism®3730 automated sequencer (Applied Biosystems, Foster City, USA).…”