Sildenafil Does Not Prevent Heart Hypertrophy and Fibrosis Induced by Cardiomyocyte Angiotensin II Type 1 Receptor Signaling

Abstract

Analyses of several mouse models imply that the phosphodiesterase 5 (PDE5) inhibitor sildenafil (SIL), via increasing cGMP, affords protection against angiotensin II (Ang II)-stimulated cardiac remodeling. However, it is unclear which cell types are involved in these beneficial effects, because Ang II may exert its adverse effects by modulating multiple renovascular and cardiac functions via Ang II type 1 receptors (AT 1 Rs). To test the hypothesis that SIL/cGMP inhibit cardiac stress provoked by amplified Ang II/AT 1 R directly in cardiomyocytes (CMs), we studied transgenic mice with CM-specific overexpression of the AT 1 R under the control of the a-myosin heavy chain promoter (aMHC-AT 1 R tg/1 ). The extent of cardiac growth was assessed in the absence or presence of SIL and defined by referring changes in heart weight to body weight or tibia length. Hypertrophic marker genes, extracellular matrix-regulating factors, and expression patterns of fibrosis markers were examined in aMHC-AT 1 R tg/1 ventricles (with or without SIL) and corroborated by investigating different components of the natriuretic peptide/PDE5/cGMP pathway as well as cardiac functions. cGMP levels in heart lysates and intact CMs were measured by competitive immunoassays and Förster resonance energy transfer. We found higher cardiac and CM cGMP levels and upregulation of the cGMP-dependent protein kinase type I with AT 1 R overexpression. However, even a prolonged SIL treatment regimen did not limit the progressive CM growth, fibrosis, or decline in cardiac functions in the aMHC-AT 1 R tg/1 model, suggesting that SIL does not interfere with the pathogenic actions of amplified AT 1 R signaling in CMs. Hence, the cardiac/ noncardiac cells involved in the cross-talk between SIL-sensitive PDE activity and Ang II/AT 1 R still need to be identified.

Sildenafil Protects against Myocardial Ischemia-Reperfusion Injury Following Cardiac Arrest in a Porcine Model: Possible Role of the Renin-Angiotensin System

“…We think this difference may be due to the discrepancy between our CAR model and their hypertensive model. Furthermore, Straubinger J et al reported that they found higher cGMP levels in cultured cardiomyocytes and AT1R overexpression upregulated the cGMP-dependent protein kinase type I [ 31 ]. However, they also found that the progressive cardiomyocytes hypotrophy and fibrosis was not prevented by prolonged sildenafil treatment in the AT1R heart-specific transgenic mice model [ 31 ].…”

Amplified pathogenic actions of angiotensin II in cysteine‐rich LIM‐only protein 4–negative mouse hearts

“…For in vitro experiments, samples derived from both genders (7–10 wk) were included in the analyses. In an additional series of experiments, transgenic mice carrying a CM‐specific overexpression of the human Ang II type 1 receptor (AT 1 R) under the control of the α‐myosin heavy chain promoter (αMHC‐AT 1 R tg/+ ) (24, 25) were crossed with CRP4 −/− animals to produce αMHC‐AT 1 R tg/+ /CRP4 +/− parent animals for subsequent breeding steps. Mating of these mice with CRP4 +/− animals produced male double‐mutant offspring (αMHC‐AT 1 R tg/+ /CRP4 −/− ), which were compared at an age of ~60 wk to αMHC‐AT 1 R tg/+ /CRP4 +/+ controls on a mixed Sv129/C57Bl6 back‐ground for their progressive cardiac remodeling phenotype in response to prolonged overexpression of the AT 1 R specifically in CMs.…”

“…Mating of these mice with CRP4 +/− animals produced male double‐mutant offspring (αMHC‐AT 1 R tg/+ /CRP4 −/− ), which were compared at an age of ~60 wk to αMHC‐AT 1 R tg/+ /CRP4 +/+ controls on a mixed Sv129/C57Bl6 back‐ground for their progressive cardiac remodeling phenotype in response to prolonged overexpression of the AT 1 R specifically in CMs. Genotyping of all experimental mice was performed by PCR analysis of tail‐tip DNA using CRP4 ( CRP4 forward 1: 5′‐AGGCTTTCCATTGGGATGTG‐3′, CRP4 forward 2: 5′‐ACAGATGGAATCCATGGAGGA‐3′, CRP4 reverse: 5′‐GCGCGGTCTAGTGGGCAT‐3′) or AT 1 R‐specific primers ( AT 1 R forward: 5′‐ACCCTTACCCCACATAGAC‐3′; AT 1 R reverse: 5′‐ACCATCTTCAGTAGAGTTG‐3′) according to previously published protocols (9, 24, 25). AT 1 R transgenic mice were identified by a 400‐bp amplicon, whereas the CRP4‐specific PCR resulted in amplicons with a molecular size of 500 and 421 bp identifying the WT and KO alleles, respectively.…”

H‐ ras deletion protects against angiotensin II–induced arterial hypertension and cardiac remodeling through protein kinase G‐Iβ pathway activation

“…There are more conflicting results on the use of the phosphodiesterase 5 inhibitor, sildenafil, which elevates the cGMP content and increases PKG‐I activity. In a mouse model with cardiomyocyte‐specific overexpression of the AngII type 1 receptor, sildenafil treatment did not prevent heart hypertrophy and fibrosis (52). Sildenafil reversed thoracic aorta constriction‐induced cardiac hypertrophy (48), whereas little antihypertrophic effect in wild‐type mice and no effect in βRM mice with AngII infusion was observed (51), although, in the same study, a large effect of sildenafil was observed on fibrosis in wild‐type, but not βRM mice, which suggests that PKG‐I present in cardiac cells is an important regulator of cardiac fibrosis (51).…”