Simple and rapid determination of the acetaldehyde dehydrogenase (ALDH2) genotypes by nonradioactive single‐strand conformation polymorphism analysis

Abstract

The genotyping of mitochondrial acetaldehyde dehydrogenase (ALDH2) is very important in alcohol studies. We describe an ALDH2 genotyping method based on nonradioactive single-strand conformation polymorphism (SSCP) analysis on mini-gels following amplification with a mutated primer set. The three ALDH2 genotypes were clearly and unambiguously distinguished. This method was applied to the ALDH2 genotyping of 129 unrelated Japanese. The allele frequency of ALDH2*2 was calculated to be 0.271, which was consistent with the previous data. The method proved to be simple, rapid and reliable, and dispensed with isotopic reagent and expensive restriction enzymes and equipment. The SSCP method described here is valuable in routine ALDH2 genotyping.

Effect of ALDH2 and CYP2E1 Gene Polymorphisms on Drinking Behavior and Alcoholic Liver Disease in Japanese Male Workers

“…Genomic DNA samples were isolated from peripheral white blood cells by using a DNA extracting kit (DnaQuick; Dainipponseiyaku Co. Ltd., Osaka, Japan). The ALDH2 genotype was analyzed by polymerase chain reaction (PCR), followed by single-strand conformation polymorphism (SSCP) according to Yuasa et al (1997). The PCR was carried out in a final volume of 25 l of buffer that contained 2 l (10 -100 ng) of genomic DNA, forward primer (5' CAAATTACAGGGTCAACTGCT) 5 pmol, reverse primer (5'-CCACACTAACAGTTTTCACTT) 5 pmol, 200 M of each nucleotide (deoxyadenosine 5'-triphosphate, deoxyguanosine 5'triphosphate, deoxycytidine 5'-triphosphate, and thymidine 5'triphosphate), 2 l of 25 mM MgCl 2 , and 0.5 units of Taq DNA polymerase (Takara Schuzo Co. Ltd., Shiga, Japan).…”

Effect of ALDH2 and CYP2E1 Gene Polymorphisms on Drinking Behavior and Alcoholic Liver Disease in Japanese Male Workers

“…The ALDH2 genotype was analyzed by polymerase chain reaction (PCR), followed by single-strand conformation polymorphism (SSCP) according to Yuasa et al (1997). The PCR was carried out in a final volume of 25 l of buffer that contained 2 l (10 -100 ng) of genomic DNA, forward primer (5' CAAATTACAGGGTCAACTGCT) 5 pmol, reverse primer (5'-CCACACTAACAGTTTTCACTT) 5 pmol, 200 M of each nucleotide (deoxyadenosine 5'-triphosphate, deoxyguanosine 5'-triphosphate, deoxycytidine 5'-triphosphate, and thymidine 5'-triphosphate), 2 l of 25 mM MgCl 2 , and 0.5 units of Taq DNA polymerase (Takara Schuzo Co. Ltd., Shiga, Japan).…”

PCR-SSCP: A Method for Reliably Detecting Single Nucleotide Polymorphisms in Multifactorial Diseases

“…Different detection methods are utilized, including autoradiography of labeled PCR fragments [6]. ethidium bromide staining [8] or silver staining [9,10]. Here we describe our experience with PCR-SSCP to detect efficiently SNPs for DNA profiling of candidate genes in multifactorial diseases.…”