Simple, sensitive and robust chicken specific sexing assays, compliant with large scale analysis

He, Liyan; Martins, Priscila Silveira; Huguenin, Joris; Van, Thi Nhu Ngoc; Manso, Taciana; Galindo, Therese; Gregoire, Flavien; Catherinot, Lise; Molina, Franck; Espeut, Julien

doi:10.1371/journal.pone.0213033

Cited by 27 publications

(21 citation statements)

References 25 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The sex of each duck was determined from raw read counts of the SWIM6 gene (LOC101797738) in each RNA sample. SWIM6 is located on the W chromosome found in WZ females, but not ZZ males, and was established as a valid determinant of avian embryo sex by He and colleagues (29). A table of each sample name and corresponding sex of the duck can be found in Supplementary File 1.…”

Section: Methods Viral Infection and Rna Collectionmentioning

confidence: 99%

Tissue Specific Transcriptome Changes Upon Influenza A Virus Replication in the Duck

et al. 2021

View full text Add to dashboard Cite

Ducks are the natural host and reservoir of influenza A virus (IAV), and as such are permissive to viral replication while being unharmed by most strains. It is not known which mechanisms of viral control are globally regulated during infection, and which are specific to tissues during infection. Here we compare transcript expression from tissues from Pekin ducks infected with a recombinant H5N1 strain A/Vietnam 1203/04 (VN1203) or an H5N2 strain A/British Columbia 500/05 using RNA-sequencing analysis and aligning reads to the NCBI assembly ZJU1.0 of the domestic duck (Anas platyrhynchos) genome. Highly pathogenic VN1203 replicated in lungs and showed systemic dissemination, while BC500, like most low pathogenic strains, replicated in the intestines. VN1203 infection induced robust differential expression of genes all three days post infection, while BC500 induced the greatest number of differentially expressed genes on day 2 post infection. While there were many genes globally upregulated in response to either VN1203 or BC500, tissue specific gene expression differences were observed. Lungs of ducks infected with VN1203 and intestines of birds infected with BC500, tissues important in influenza replication, showed highest upregulation of pattern recognition receptors and interferon stimulated genes early in the response. These tissues also appear to have specific downregulation of inflammatory components, with downregulation of distinct sets of proinflammatory cytokines in lung, and downregulation of key components of leukocyte recruitment and complement pathways in intestine. Our results suggest that global and tissue specific regulation patterns help the duck control viral replication as well as limit some inflammatory responses in tissues involved in replication to avoid damage.

show abstract

Section: Methods Viral Infection and Rna Collectionmentioning

confidence: 99%

Tissue Specific Transcriptome Changes Upon Influenza A Virus Replication in the Duck

et al. 2021

View full text Add to dashboard Cite

show abstract

“…In comparison, the gold standard qPCR discriminated female from male chicks after 13 PCR amplification cycles. In practice, for qPCR, due to the requirement to complete the entire testing program (∼30 cycles) prior to performing the final analysis of the results, the testing time is 1–2 h. For example, in a recent study that used qPCR for chick sexing and targeted the Xho I repetitive sequence, the total assay time was ∼2 h. 30…”

Section: Resultsmentioning

confidence: 99%

Rapid and Sensitive Detection of Repetitive Nucleic Acid Sequences Using Magnetically Modulated Biosensors

Margulis

Danielli

2019

ACS Omega

View full text Add to dashboard Cite

Repetitive DNA sequences are abundant in the genome of most biological species. These sequences are naturally “preamplified”, which makes them a preferential target for a variety of biological assays. Current methods to detect specific DNA sequences are based on the quantitative polymerase chain reaction (PCR), which relies on target amplification by Taq polymerase and uses a fluorescent resonance energy transfer (FRET)-based probe. Here, to rapidly detect a repetitive DNA sequence, we combine a highly sensitive magnetic modulation biosensing (MMB) system and a modified double-quenched FRET-based probe. The high numbers of copies of the female-specific Xho I sequence of the domestic chicken ( Gallus gallus ), combined with the low background fluorescence levels of the modified double-quenched probe and the high sensitivity of the MMB system, allow us to determine the chick sex in ovo within 13 min, with 100% sensitivity and specificity. Compared to quantitative PCR, the presented assay is 4–9 times faster. More broadly, by specifically tailoring the primers and probe, the proposed assay can detect any target DNA sequence, either repetitive or nonrepetitive.

show abstract

“…Molecular sexing was performed as previously published with minor adjustments ( He et al, 2019 ). Small pieces of EID11, EID13 and EID15 embryo livers were lysed in 150 μl of lysis buffer containing 10% of chelating beads (Chelex 100), 0.2% SDS, 10 mM Tris pH 8 and 0.2 mg/ml Proteinase K).…”

Section: Methodsmentioning

confidence: 99%

“…Embryo lysates were diluted ten times in nuclease free water and 1 μl of dilution was mixed on ice with primer SWIM (forward: 5′- GAGATCACGAACTCAACCAG -3′/reverse: 5′- CCAGACCTAATACGGTTTTACAG -3′), which is female specific and primer 12S (forward-5′ CTATAATCGATAATCCACGATTCA- 3′, reverse: 5′- CTTGACCTGTCTTATTAGCGAGG -3′) and Dream Taq PCR Master Mix (2X), according to the manufacturer’s recommendations (Thermo Fisher Scientific, Illkirch, France). Amplification by polymerase chain reaction (PCR) was performed using a thermocycler (Eppendorf, Montesson, France), as described previously ( He et al, 2019 ). PCR products were loaded on a 2% agarose gel containing 0.01% gel Red in 1X TAE buffer, and separated by electrophoresis at 100 V. Gels were imaged using a Bio-Print imager (Vilber Lourmat, Marne-la-Vallée, France).…”

Section: Methodsmentioning

confidence: 99%

How Egg Storage Duration Prior to Incubation Impairs Egg Quality and Chicken Embryonic Development: Contribution of Imaging Technologies

et al. 2022

View full text Add to dashboard Cite

Storing fertilised eggs prior to incubation is a frequent practice in commercial hatcheries to coordinate activities and synchronise hatchings. However, the conditions used to store eggs can have major impacts on egg quality and the subsequent viability of chicken embryos. While storage temperatures of 16–18°C are classically used in hatcheries, the duration of storage varies from three to more than 10 days. We explored the effect of storage duration (zero, three or 10 days; D0, D3 and D10, respectively) at 16°C, 80% relative humidity (RH) on egg quality (Broiler, Ross 308), using computed tomography (CT) and classical measurements (egg weight, eggshell strength, egg white pH, Haugh units, yolk index and colour). The results revealed that a storage duration of up to 10 days negatively affected some egg quality traits (yolk index and volume, air chamber volume and egg white pH). Eggs stored for three or 10 days were further incubated for 11, 13 or 15 days (37.8°C, 55% RH). Eggs were analysed by magnetic resonance imaging (MRI) and CT to assess the development of the embryo and internal egg changes occurring during incubation. First, data showed that the fertility and sex ratio of eggs were not affected by storage duration. However, the mortality of viable eggs was increased in the D10 group compared to the D3 group. Results of non-invasive imaging technologies revealed that the storage of eggs for 10 days impaired embryo growth as early as 11 days of incubation (decrease in brain and embryo volumes). Collectively, these data provide new evidence that the duration of egg storage negatively affects embryonic growth. They further corroborate that this parameter is likely to be crucial to synchronising embryonic stages and maybe reducing the hatching window, hence limiting the time spent by newborn chicks in hatchers. In addition, our results highlight that CT and MRI imaging technologies are useful non-invasive tools to evaluate egg quality prior to incubation and the impact of storage (or incubation) practices on developmental growth of the embryo.

show abstract

Simple, sensitive and robust chicken specific sexing assays, compliant with large scale analysis

Cited by 27 publications

References 25 publications

Tissue Specific Transcriptome Changes Upon Influenza A Virus Replication in the Duck

Tissue Specific Transcriptome Changes Upon Influenza A Virus Replication in the Duck

Rapid and Sensitive Detection of Repetitive Nucleic Acid Sequences Using Magnetically Modulated Biosensors

How Egg Storage Duration Prior to Incubation Impairs Egg Quality and Chicken Embryonic Development: Contribution of Imaging Technologies

Contact Info

Product

Resources

About