Single-vector inducible lentiviral RNAi system for oncology target validation

Wiederschain, Dmitri; Wee, Susan; Chen, Lin; Loo, Alice; Yang, Guizhi; Huang, Alan; Chen, Yan; Caponigro, Giordano; Yao, Yung Mae; Lengauer, Christoph; Sellers, William R.; Benson, Jalen

doi:10.4161/cc.8.3.7701

Cited by 399 publications

(318 citation statements)

References 17 publications

Supporting

Mentioning

316

Contrasting

Unclassified

Order By: Relevance

“…Upon addition of Dox, transcription is resumed as Dox binds to TetR releasing it from the promoter. 43 This system enables temporal control of shRNA expression at preferred times during the experiment, which is essential for studying genes that may have adverse effect on cell viability or other biological processes, for example, cytoskeletal re-organization. 44 For example, during myogenic differentiation, we observed a considerable level of cytotoxicity in cells actively expressing Rock1 shRNA (data not shown), making data interpretation difficult.…”

Section: Discussionmentioning

confidence: 99%

A novel lentivirus for quantitative assessment of gene knockdown in stem cell differentiation

et al. 2012

View full text Add to dashboard Cite

Loss of gene function is a valuable tool for screening genes in cellular processes including stem cell differentiation differentiation. However, the criteria for evaluating gene knockdown are usually based on end-point analysis and real-time, dynamic information is lacking. To overcome these limitations, we engineered a shRNA encoding LentiViral Dual Promoter vector (shLVDP) that enabled real-time monitoring of mesenchymal stem (MSC) differentiation and simultaneous gene knockdown. In this vector, the activity of the alpha-smooth muscle actin (aSMA) promoter was measured by the expression of a destabilized green fluorescent protein, and was used as an indicator of myogenic differentiation; constitutive expression of discosoma red fluorescent protein was used to measure transduction efficiency and to normalize aSMA promoter activity; and shRNA was encoded by a doxycycline (Dox)-regulatable H1 promoter. Importantly, the normalized promoter activity was independent of lentivirus titer allowing quantitative assessment of gene knockdown. Using this vector, we evaluated 11 genes in the TGF-b1 or Rho signaling pathway on SMC maturation and on MSC differentiation along the myogenic lineage. As expected, knockdown of genes such as Smad2/3 or RhoA inhibited myogenic differentiation, while knocking down the myogenic differentiation inhibitor, Klf4, increased aSMA promoter activity significantly. Notably, some genes for example, Smad7 or KLF4 showed differential regulation of myogenic differentiation in MSC from different anatomic locations such as bone marrow and hair follicles. Finally, Dox-regulatable shRNA expression enabled temporal control of gene knockdown and provided dynamic information on the effect of different genes on myogenic phenotype. Our data suggests that shLVDP may be ideal for development of lentiviral microarrays to decipher gene regulatory networks of complex biological processes such as stem cell differentiation or reprogramming.

show abstract

Section: Discussionmentioning

confidence: 99%

A novel lentivirus for quantitative assessment of gene knockdown in stem cell differentiation

et al. 2012

View full text Add to dashboard Cite

show abstract

“…pLKO-Tet-OnshRNA-Snail was generated by ligation of the double stranded oligo 5 0 -CCGGCCA GGCTCGAAAGGCCTTCAACTCGAGTTGAAGGCCTTTCGAGCCTGGTTTTT-3 0 between the AgeI and EcoRI sites in the pLKO-Tet-On vector as described. 67 To produce DU145-empty and DU145-Bcl-XL cell lines, DU145 cells were transduced either with pCDH-CMV-MCS-EFI-Neo or with pCDH-EFI-Neo-Bcl-XL viral particles. 68 For inducible RNAi of Snail, DU145 were transduced with pLKO-TetOn-shRNA-Snail particles.…”

Section: Methodsmentioning

confidence: 99%

Radiotherapy-induced plasticity of prostate cancer mobilizes stem-like non-adherent, Erk signaling-dependent cells

et al. 2014

View full text Add to dashboard Cite

Fractionated ionizing radiation combined with surgery or hormone therapy represents the first-choice treatment for medium to high-risk localized prostate carcinoma. One of the main reasons for the failure of radiotherapy in prostate cancer is radioresistance and further dissemination of surviving cells. In this study, exposure of four metastasis-derived human prostate cancer cell lines (DU145, PC-3, LNCaP and 22RV1) to clinically relevant daily fractions of ionizing radiation (35 doses of 2 Gy) resulted in generation of two radiation-surviving populations: adherent senescent-like cells expressing common senescenceassociated markers and non-adherent anoikis-resistant stem cell-like cells with active Notch signaling and expression of stem cell markers CD133, Oct-4, Sox2 and Nanog. While a subset of the radiation-surviving adherent cells resumed proliferation shortly after completion of the irradiation regimen, the non-adherent cells started to proliferate only on their reattachment several weeks after the radiation-induced loss of adhesion. Like the parental non-irradiated cells, radiation-surviving re-adherent DU145 cells were tumorigenic in immunocompromised mice. The radiation-induced loss of adhesion was dependent on expression of Snail, as siRNA/shRNA-mediated knockdown of Snail prevented cell detachment. On the other hand, survival of the non-adherent cells required active Erk signaling, as chemical inhibition of Erk1/2 by a MEK-selective inhibitor or Erk1/2 knockdown resulted in anoikis-mediated death in the non-adherent cell fraction. Notably, whereas combined inhibition of Erk and PI3K-Akt signaling triggered cell death in the non-adherent cell fraction and blocked proliferation of the adherent population of the prostate cancer cells, such combined treatment had only marginal if any impact on growth of control normal human diploid cells. These results contribute to better understanding of radiation-induced stress response and heterogeneity of human metastatic prostate cancer cells, document treatment-induced plasticity and phenotypically distinct cell subsets, and suggest the way to exploit their differential sensitivity to radiosensitizing drugs in overcoming radioresistance. Cell Death and Differentiation (2015) 22, 898-911; doi:10.1038/cdd.2014.97; published online 11 July 2014Prostate carcinoma (CaP) is the most frequent type of cancer in men, and the sixth cause of cancer-associated death in men worldwide. 1 Despite the advances in diagnosis and therapy of CaP, the mortality has remained almost unchanged for the last decades. Currently, the most successful treatment for localized CaP is prostatectomy with postoperative fractionated radiotherapy, significantly improving metastasis-free and overall survival, where the median of a 15-year survival is around 47% of patients. 2,3 The rest of the patients develop a metastatic disease that is incurable due to the resistance of CaP to androgen ablation, radiotherapy and chemotherapy. Therefore, understanding the mechanisms of radioresistance and chemoresista...

show abstract

“…HCC1954 expressing doxycycline inducible shRNA hairpins (sequences are available on request) targeting raptor or PTEN were established using the pLKO-Tet-ON lentiviral system as described in ref. 37.…”

Section: Methodsmentioning

confidence: 99%

Specific apoptosis induction by the dual PI3K/mTor inhibitor NVP-BEZ235 in HER2 amplified and PIK3CA mutant breast cancer cells

Brachmann

Hofmann

Schnell

et al. 2009

Proc. Natl. Acad. Sci. U.S.A.

273

219

View full text Add to dashboard Cite

NVP-BEZ235 is a dual PI3K/mTOR inhibitor currently in phase I clinical trials. We profiled this compound against a panel of breast tumor cell lines to identify the patient populations that would benefit from such treatment. In this setting, NVP-BEZ235 selectively induced cell death in cell lines presenting either HER2 amplification and/or PIK3CA mutation, but not in cell lines with PTEN loss of function or KRAS mutations, for which resistance could be attributed, in part to ERK pathway activity. An in depth analysis of death markers revealed that the cell death observed upon NVP-BEZ235 treatment could be recapitulated with other PI3K inhibitors and that this event is linked to active PARP cleavage indicative of an apoptotic process. Moreover, the effect seemed to be partly independent of the caspase-9 executioner and mitochondrial activated caspases, suggesting an alternate route for apoptosis induction by PI3K inhibitors. Overall, this study will provide guidance for patient stratification for forthcoming breast cancer phase II trials for NVP-BEZ235.kinase inhibitor ͉ small molecule ͉ PI3K ͉ breat cancer ͉ mTOR

show abstract

Single-vector inducible lentiviral RNAi system for oncology target validation

Cited by 399 publications

References 17 publications

A novel lentivirus for quantitative assessment of gene knockdown in stem cell differentiation

A novel lentivirus for quantitative assessment of gene knockdown in stem cell differentiation

Radiotherapy-induced plasticity of prostate cancer mobilizes stem-like non-adherent, Erk signaling-dependent cells

Specific apoptosis induction by the dual PI3K/mTor inhibitor NVP-BEZ235 in HER2 amplified and PIK3CA mutant breast cancer cells

Contact Info

Product

Resources

About