Small-Molecule Modulators of the ATPase VCP/p97 Affect Specific p97 Cellular Functions

Abstract

VCP/p97 belongs to the AAA+ ATPase family and has an essential role in several cellular processes ranging from cell division to protein homeostasis. Compounds targeting p97 inhibit the main ATPase domain and cause cell death. Here, using PNA-encoded chemical libraries, we have identified two small molecules that target the regulatory domain of p97, comprising the N-terminal and the D1 ATPase domains, and do not cause cell death. One molecule, NW1028, inhibits the degradation of a p97-dependent reporter, whereas the other, NW1030, increases it. ATPase assays show that NW1028 and NW1030 do not affect the main catalytic domain of p97. Mapping of the binding site using a photo-affinity conjugate points to a cleft at the interface of the N-terminal and the D1 ATPase domains. We have therefore discovered two new compounds that bind to the regulatory domain of p97 and modulate specific p97 cellular functions. Using these compounds, we have revealed a role for p97 in the regulation of mitotic spindle orientation in HeLa cells.Chemicals used in this study are: MG132 and DBeQ (Sigma-Aldrich), NMS-873 (Xcessbio), chloroquine (Enzo lifescience), cycloheximide (Millipore), puromycin (Sigma-Aldrich), G418 (InvivoGen) and luciferin (AppliChem). Cell culture and transfections. The following cell lines were gifts from specified groups: HeLa cells expressing UbG76V-GFP and ODD-LUC, gift of T. Chou 16 (Harbor-UCLA Medical Center and Los Angeles Biomedical Research Institute, USA); HEK 293T, RPE1, HeLa, HeLa H2B-mCherry/GFP-α-tubulin41 from P. Meraldi (University of Geneva, Switzerland); MEF cells expressing mCherry-GFP-LC3b, from P. Taylor (Tresse et al., 2010) (St. Jude Children's Research Hospital, USA).Cell lines were grown in Dulbecco's modified eagle medium (Gibco DMEM) supplemented with FCS 10%, penicillin 100units/ml and streptomycin 100mg/ml) at 37°C with 5% CO2 in a humified incubator. HEK 293T cells were supplemented with 1% Glutamine. HeLa cells expressing UbG76V-GFP and ODD-LUC were selected with 2.5µg/ml puromycin and 0.1mg/ml G418(Chou and Deshaies, 2011). Transient expression was performed using lipofectamine 2000 (Invitrogen) according to the manufacturer's protocol.Plasmids and oligonucleotides. The following constructs were used in this work for protein expression and site-directed mutagenesis: pQE9-His-p97deltaD2 was provided by Addgene (ID17229); pET15-His-p97 and pET24b-His-p97ND1L was provided by TF. Chou 34 (Harbor-UCLA Medical Center and Los Angeles Biomedical Research Institute, USA).The mutant p97 E305Q were obtained by site-directed mutagenesis using the following oligonucleotides: p97 E305Q (forward: GCCATCATCTTCATTGAT CAGCTAGATGCCATCGCTCCC; reverse: GGGAGCGATGGCATCTAGCTGATCAATGAAGATGATGGC). The following oligonucleotides were used to verify the site-directed mutagenesis:ATGGCTTCTGGAGCCGATTC, TTACCCGATGTCTTCCCAGGTTAC, GTAACCTGGGAAGACATCGGG, GGAACAGGTAGCCAATGAGACTC and GGCCATCCGTGAATCCATCG.Recombinant protein expression and purification. All recombinant proteins (ND1L and p97 E305Q) were expressed in E.co...

Compounds activating VCP D1 ATPase enhance both autophagic and proteasomal neurotoxic protein clearance

“…A recent study identified the VCP binding compound NW1030 and showed that, similarly to SMER28, it binds to a cleft between the N-terminal domain and D1 ATPase domain of VCP to selectively stimulate D1 ATPase activity 47 and that this increased ATPase activity potentially correlates with an increase in autophagic flux. Interestingly, two of the three peptides identified by LiP-MS to interact with SMER28 overlap with two peptides identified as interactors of NW1030 (Fig.…”

Valosin-Containing Protein (VCP)/p97: A Prognostic Biomarker and Therapeutic Target in Cancer

“…NW1028 inhibited the degradation of a VCP-dependent reporter, whereas NW1030 increased its degradation. However, treatment with NW1028 and NW1030 affected the mitotic process in HeLa cells, thus revealing a role for VCP/p97 in the regulation of mitotic spindle orientation [ 175 ].…”

Trends in Hit-to-Lead Optimization Following DNA-Encoded Library Screens

“…Enzymes are far overrepresented (13 out of 15 DEL hit-to-lead papers, versus 28% of drugs) and DEL hit-to-lead success rates and trends may differ for nonenzyme targets. Interestingly, DEL screens for other target classes have been reported, − both for soluble (including nuclear receptors, structural proteins, and transcription factors) and membrane-bound proteins (GPCRs). But hit-to-lead optimizations based on these screens have not been published; it is unclear from the literature whether this reflects the optimizability of DEL hits for these targets.…”