smiFISH and embryo segmentation for single-cell multi-gene RNA quantification in arthropods

Calvo, Llilians; Ronshaugen, Matthew; Pettini, Tom

doi:10.1038/s42003-021-01803-0

Cited by 25 publications

(18 citation statements)

References 37 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…For a more direct comparison of the spatial/temporal expression of the KozakGAL4 allele and the targeted gene, we compared their RNA expression patterns by in situ hybridization. We employed smiFISH (single molecule Fluorescent In-Situ Hybridization) in third instar larval brains for eight genes ( Calvo et al, 2021 ; Yang et al, 2017 ). We crossed the KozakGAL4 alleles of these genes ( Setx , CG7943 , CG8202 , CG8778 , CG15093 , IntS11 , ZnT49B , and Vps29 ) to yw flies with wild-type alleles of these genes and performed costaining of the GAL4 mRNA, expressed by the KozakGAL4 allele, and the targeted gene mRNA, expressed from the wild-type allele of the gene.…”

Section: Resultsmentioning

confidence: 99%

See 1 more Smart Citation

An expanded toolkit for Drosophila gene tagging using synthesized homology donor constructs for CRISPR-mediated homologous recombination

Kanca

Zirin

et al. 2022

eLife

View full text Add to dashboard Cite

Previously, we described a large collection of Drosophila strains that each carry an artificial exon containing a T2AGAL4 cassette inserted in an intron of a target gene based on CRISPR-mediated homologous recombination (Lee et al., 2018). These alleles permit numerous applications and have proven to be very useful. Initially, the homologous recombination-based donor constructs had long homology arms (>500 bps) to promote precise integration of large constructs (>5kb). Recently, we showed that in vivo linearization of the donor constructs enables insertion of large artificial exons in introns using short homology arms (100-200 bps) (Kanca et al., 2019a). Shorter homology arms make it feasible to commercially synthesize homology donors and minimize the cloning steps for donor construct generation. Unfortunately, about 58% of Drosophila genes lack a suitable coding intron for integration of artificial exons in all of the annotated isoforms. Here, we report the development of new set of constructs that allow the replacement of the coding region of genes that lack suitable introns with a KozakGAL4 cassette, generating a knock-out/knock-in allele that expresses GAL4 similarly as the targeted gene. We also developed custom vector backbones to further facilitate and improve transgenesis. Synthesis of homology donor constructs in custom plasmid backbones that contain the target gene sgRNA obviates the need to inject a separate sgRNA plasmid and significantly increases the transgenesis efficiency. These upgrades will enable the targeting of nearly every fly gene, regardless of exon-intron structure, with a 70-80% success rate.

show abstract

Section: Resultsmentioning

confidence: 99%

“…X-FLAP ( CACTGAGTCCAGCTCGAAACTTAGGAGG ) oligos tagged with Cy3 or Cy5 were also ordered from Sigma-Aldrich at 0.025 µM synthesis scale. Gene-specific oligos were pooled and annealed to X-FLAP oligos as described in Calvo et al, 2021 at 20 µM scale.…”

Section: Methodsmentioning

confidence: 99%

An expanded toolkit for Drosophila gene tagging using synthesized homology donor constructs for CRISPR-mediated homologous recombination

Kanca

Zirin

et al. 2022

eLife

View full text Add to dashboard Cite

show abstract

“…However, we found the variation between transcript numbers in different embryos to be greater than any reduction that would be expected over such a short time frame (~ 4 mins) due to degradation (Figure S4B-E). As a result, any reduction due to degradation is masked by high variation between embryos, as has previously been observed for other mRNA numbers in the Drosophila embryo [36]. The snail mRNA numbers are tightly controlled by negative autoregulation [23], suggesting that snail may be uniquely suited to this method for calculating half-life.…”

Section: Resultsmentioning

confidence: 97%

Single molecule imaging and modelling of mRNA decay dynamics in theDrosophilaembryo

Beadle

Love

Shapovalova

et al. 2022

Preprint

View full text Add to dashboard Cite

Regulation of mRNA degradation is critical for a diverse array of cellular processes and developmental cell fate decisions. Although many methods for determining mRNA half-lives rely on transcriptional inhibition or metabolic labelling, these manipulations can influence half-lives or introduce errors in the measurements. Here we use a non-invasive method for estimating mRNA half-lives globally in the early Drosophila embryo using a total RNA-seq time series and Gaussian process regression to model the dynamics of premature and mature mRNAs. We show how regulation of mRNA stability is used to establish a range of mature mRNA dynamics during embryogenesis, despite shared transcription profiles. Our data suggest that mRNA half-life is not dependent on translation efficiency, but instead we provide evidence that short half-life mRNAs are more strongly associated with P-bodies. Moreover, we detect an enrichment of mRNA 3' ends in P-bodies in the early embryo, consistent with 5' to 3' degradation occurring in P-bodies for at least a subset of mRNAs. We discuss our findings in relation to recently published data suggesting that the primary function of P-bodies in other biological contexts is mRNA storage.

show abstract

“…To age sog attP and y 1 w 67c23 control embryos stained with anti- sog and anti- lacZ smFISH and anti-Spectrin antibody, maximum intensity projections of images were made, and the length of the cell membrane ingression (Spectrin antibody stain) was measured ( Calvo et al, 2021 ). Embryos with cell membranes of 3.5–5.5 μm were used for analysis.…”

Section: Methodsmentioning

confidence: 99%

Modelling the structure of Short Gastrulation and generation of a toolkit for studying its function in Drosophila

et al. 2022

View full text Add to dashboard Cite

A BMP gradient is essential for patterning the dorsal-ventral axis of invertebrate and vertebrate embryos. The extracellular BMP binding protein Short Gastrulation (Sog) in Drosophila plays a key role in BMP gradient formation. In this study, we combine genome editing, structural and developmental approaches to study Sog function in Drosophila. We generate a sog knockout fly stock, which allows simple reintegration of altered versions of the sog coding sequence. As proof-of-principle, we test the requirement for two cysteine residues that were previously identified as targets for palmitoylation, which has been proposed to enhance Sog secretion. However, we show that the SogC27,28S mutant is viable with only very mild phenotypes, indicating that these residues and their potential modification are not critical for Sog secretion in vivo. Additionally, we use experimental negative stain EM imaging and hydrodynamic data to validate the AlphaFold structure prediction for Sog. The model suggests a more compact shape than the vertebrate ortholog Chordin and conformational flexibility between the C-terminal von Willebrand C domains. We discuss how this altered compactness may contribute to mechanistic differences in Sog and Chordin function during BMP gradient formation.

show abstract

smiFISH and embryo segmentation for single-cell multi-gene RNA quantification in arthropods

Cited by 25 publications

References 37 publications

An expanded toolkit for Drosophila gene tagging using synthesized homology donor constructs for CRISPR-mediated homologous recombination

An expanded toolkit for Drosophila gene tagging using synthesized homology donor constructs for CRISPR-mediated homologous recombination

Single molecule imaging and modelling of mRNA decay dynamics in theDrosophilaembryo

Modelling the structure of Short Gastrulation and generation of a toolkit for studying its function in Drosophila

Contact Info

Product

Resources

About