Solid‐Phase Supports for Oligonucleotide Synthesis

Guzaev, Andrei

doi:10.1002/0471142700.nc0301s53

Cited by 10 publications

(7 citation statements)

References 314 publications

(471 reference statements)

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The reduction of process-related impurities achieved using the CPG support 9 for solid-phase synthesis was measured for each DNA and RNA sequence, as described above for the DNA sequence 5 -d(TCTTGGTTACATGAAATCCT) and reported in the annotation to step 13 of Basic Protocol 6. Over the years, a plethora of solid supports has attracted attention in the context of oligonucleotide synthesis (see Current Protocols article: Guzaev, 2013). For example, the NittoPhase® solid support is a commercially available porous cross-linked polystyrene support with a high hydroxyl load and a pore size of ∼550 Å.…”

Section: Critical Parameters and Troubleshootingmentioning

confidence: 99%

An Improved PEG‐Linked Solid Support for Minimizing Process‐Related Impurities During Solid‐Phase Synthesis of DNA and RNA Sequences

et al. 2021

View full text Add to dashboard Cite

The preparation of controlled pore glass (CPG) supports, functionalized with several hexaethylene glycol spacers, to alleviate the problems associated with the porosity of commercial CPG supports is described in this article. The pore size of CPG restricts the diffusion of reagents to the leader nucleoside embedded in porous supports; this inhibits efficient solid-phase syntheses of DNA and RNA sequences and, by default, the purity of those sequences through formation of a shorter than full-length oligonucleotide. Functionalization of a CPG support with five hexaethylene glycol spacers led to a 42% reduction in processrelated impurities contaminating oligonucleotide sequences, compared to that obtained using the commercial long-chain alkylamine (LCAA) CPG support.

show abstract

Section: Critical Parameters and Troubleshootingmentioning

confidence: 99%

An Improved PEG‐Linked Solid Support for Minimizing Process‐Related Impurities During Solid‐Phase Synthesis of DNA and RNA Sequences

et al. 2021

View full text Add to dashboard Cite

show abstract

“…Two types of a solid support are available; the most commonly used support, loaded support, has the first nucleoside attached to it, while a universal solid support is not pre‐loaded with nucleosides. Many different solid supports have been developed over the years (Guzaev, 2013). A loaded support and a commonly used universal support, UnyLinker™ (Guzaev & Manoharan, 2003; Ravikumar et al, 2008), are shown is Figure 2.…”

Section: Oligonucleotide Synthesis and Related Impuritiesmentioning

confidence: 99%

Therapeutic Oligonucleotides, Impurities, Degradants, and Their Characterization by Mass Spectrometry

Pourshahian

2019

Mass Spectrometry Reviews

View full text Add to dashboard Cite

Oligonucleotides are an emerging class of drugs that are manufactured by solid‐phase synthesis. As a chemical class, they have unique product‐related impurities and degradants, characterization of which is an essential step in drug development. The synthesis cycle, impurities produced during the synthesis and degradation products are presented and discussed. The use of liquid chromatography combined with mass spectrometry for characterization and quantification of product‐related impurities and degradants is reviewed. In addition, sequence determination of oligonucleotides by gas‐phase fragmentation and indirect mass spectrometric methods is discussed. © 2019 John Wiley & Sons Ltd. Mass Spec Rev

show abstract

“…With this advanced technology, complex polypeptides and even some proteins can be chemically synthesized. [7,8] Originating from the synthesis of peptides, this simple and practical technology is expanded to the multistep synthesis of other complex bio-organic compounds, such as oligonucleotides [9][10][11] and oligosaccharides, [12][13][14][15] and makes a profound contribution in these fields. In addition, the solid-phase synthesis of small organic molecules has been rapidly developed since 1990s.…”

Section: Introductionmentioning

confidence: 99%

Recent Progress in Solid‐Phase Total Synthesis of Naturally Occurring Small Peptides

Yan

Chen

2022

Adv Synth Catal

View full text Add to dashboard Cite

Many naturally occurring small peptides have significant therapeutic properties. Total synthesis of these peptides is not only helpful in the identification of their structures and providing methods to synthesize their analogues, but also contributes to their biosynthetic studies. As solid‐phase synthesis simplifies the tedious and time‐consuming isolation of intermediates, it has been widely applied in peptide synthesis. This review has highlighted the recent progress in solid‐phase total synthesis of both linear and cyclic naturally occurring small peptides from 2014 to July 2021.

show abstract

Solid‐Phase Supports for Oligonucleotide Synthesis

Cited by 10 publications

References 314 publications

An Improved PEG‐Linked Solid Support for Minimizing Process‐Related Impurities During Solid‐Phase Synthesis of DNA and RNA Sequences

An Improved PEG‐Linked Solid Support for Minimizing Process‐Related Impurities During Solid‐Phase Synthesis of DNA and RNA Sequences

Therapeutic Oligonucleotides, Impurities, Degradants, and Their Characterization by Mass Spectrometry

Recent Progress in Solid‐Phase Total Synthesis of Naturally Occurring Small Peptides

Contact Info

Product

Resources

About