Somatostatin and its receptors contribute in a tissue-specific manner to the sex-dependent metabolic (fed/fasting) control of growth hormone axis in mice

Abstract

Córdoba-Chacón J, Gahete MD, Castaño JP, Kineman RD, Luque RM. Somatostatin and its receptors contribute in a tissuespecific manner to the sex-dependent metabolic (fed/fasting) control of growth hormone axis in mice. Am J Physiol Endocrinol Metab 300: E46 -E54, 2011. First published October 13, 2010; doi:10.1152/ajpendo.00514.2010.-Somatostatin (SST) inhibits growth hormone (GH) secretion and regulates multiple processes by signaling through its receptors sst1-5. Differential expression of SST/ssts may contribute to sex-specific GH pattern and fastinginduced GH rise. To further delineate the tissue-specific roles of SST and sst1-5 in these processes, their expression patterns were evaluated in hypothalamus, pituitary, and stomach of male and female mice under fed/fasted conditions in the presence (wild type) or absence (SST-knockout) of endogenous SST. Under fed conditions, hypothalamic/stomach SST/ssts expression did not differ between sexes, whereas male pituitary expressed more SST and sst2A/2B/3/5A/ 5TMD2/5TMD1 and less sst1, and male pituitary cell cultures were more responsive to SST inhibitory actions on GH release compared with females. This suggests that local pituitary SST/ssts can contribute to the sexually dimorphic pattern of GH release. Fasting (48 h) reduced stomach sst2A/B and hypothalamic SST/sst2A expression in both sexes, whereas it caused a generalized downregulation of pituitary sst subtypes in male and of sst2A only in females. Thus, fasting can reduce SST sensitivity across tissues and SST input to the pituitary, thereby jointly contributing to enhance GH release. In SST-knockout mice, lack of SST differentially altered sst subtype expression levels in both sexes, supporting an important role for SST in sex-dependent control of GH axis. Evaluation of SST, IGF-I, and glucocorticoid effects on hypothalamic and pituitary cell cultures revealed that these hormones could directly account for alterations in sst2/5 expression in the physiological states examined. Taken together, these results indicate that changes in SST output and sensitivity can contribute critically to precisely define, in a tissue-dependent manner, the sex-specific metabolic regulation of the GH axis.

N-Terminal Prosomatostatin and Risk of Vascular Dementia

“…In particular, the hypothalamic-pituitary-adrenal axis hyperactivity has been found in chronic diseases affecting the endocrine, cardiovascular and nervous systems among the aging population [28]. Furthermore, somatostatin exerts pleiotropic effects through a family of 5 G protein-coupled receptor subtypes with 7 transmembrane domains, termed sst1-5, which are encoded by separate genes expressed throughout the body, including the brain, pituitary and gastrointestinal tract, where the relative abundance of receptor subtypes as well as of somatostatin is also dependent on the species, tissue, gender, and nutritional state analyzed [29]. Beyond changes in somatostatin output, also receptorial sensitivity might contribute critically to the dysfunctional modulation of neurotransmission, metabolism, and immune function, as well as the inhibition of endocrine and exocrine secretion possibly involved in pathophysiology of dementia.…”

Hepatic Long Intergenic Noncoding RNAs: High Promoter Conservation and Dynamic, Sex-Dependent Transcriptional Regulation by Growth Hormone

“…Intact and hypophysectomized adult male and female CD1 mice (8 to 12 weeks old) were purchased from Charles River Laboratories (Wilmington, MA). Livers from male and female wild-type and somatostatin-deficient mice (9 to 12 week old) were provided by R. M. Luque and R. D. Kineman (University of Illinois at Chicago, Chicago, IL) and were described previously (70,71). Liver tissues were collected from 8-to 12-week-old male and female hepatocyte-specific STAT5a/STAT5b-knockout (KO) mice and corresponding floxed control mice, provided by L. Hennighausen (NIDDK, NIH, Bethesda, MD) (72).…”

Not So Giants: Mice Lacking Both Somatostatin and Cortistatin Have High GH Levels but Show No Changes in Growth Rate or IGF-1 Levels

“…RNA extraction, quantification, and reverse transcription as well as the development, validation, and application of qPCR to measure the expression levels of different mouse transcripts have been previously reported elsewhere by our group (7,8). Total RNA was extracted from hypothalamus, pituitary gland, liver, and pancreas using an Absolutely RNA miniprep kit, with deoxyribonuclease treatment, following the manufacturer's protocol (Stratagene).…”

“…The expression level of this housekeeping gene did not differ between groups in any of the tissues analyzed. Specific sets of primer sequences used in this study have been previously reported (7,8,10,15,16), except for epithelial growth factor receptor (egf-r; accession number NM_207655.2; sense: ACAAGTAACAGGCTCAC-CCAACT, and antisense: GCAGGTTCTCCAAAGGGATT; product size: 214 bp). It should be noted that, as previously reported (13,14) and based on the stringent criteria to maximize specificity and efficiency, the qPCR technique, as applied, can be used to accurately quantify copy numbers for all mouse transcripts included in this study.…”