Some molecular characteristics of three viruses from SPVD-affected sweet potato plants in Egypt

Abstract

Sweet potato feathery mottle virus (SPFMV, genus Potyvirus, family Potyviridae), Sweet potato chlorotic stunt virus (SPCSV, genus Crinivirus, family Closteroviridae) and sweet potato virus G (SPVG) were detected in naturally infected sweet potato plants grown in the Delta region in Egypt. Before this study, SPVG was reported only from China. Two isolates of SPFMV and one isolate of SPVG were characterized for the 3'-proximal genomic sequences. Phylogenetic analyses indicated that the SPFMV isolates belong to the "russet crack" strain group (RC). Serological tests using monoclonal antibodies, and phylogenetic analysis of a partial sequence of the Hsp70 gene, indicated that the Egyptian SPCSV belongs to the so-called non-East African strain group of SPCSV.

Unravelling the genetic diversity of the three main viruses involved in Sweet Potato Virus Disease (SPVD), and its practical implications

“…Further studies are needed to determine whether SPCSV‐EA and SPCSV‐WA synergize with the same viruses and whether the mechanisms by which they induce synergism are similar. SPCSV‐EA synergizes with SPFMV and SPMMV in East African sweetpotato cultivars, but no synergism with CMV developed either in our co‐infection experiments or has been observed in East Africa in the field (unpublished data), in contrast to Israel (Cohen and Loebenstein, 1991) and Egypt (IsHak et al ., 2003) where synergism between SPCSV‐WA and CMV has been reported. It is not yet known whether these divergent results are due to differences between virus isolates or the sweetpotato cultivars used.…”

“…Similar division into two genetic strains was revealed by phylogenetic analysis of the CP and partial Hsp70h gene sequences (Alicai et al ., 1999). SPCSV‐EA has been detected serologically in Eastern and Southern Africa (Kenya, Madagascar, Uganda, Zambia; Alicai et al ., 1999; Ateka et al ., 2004; Gibson et al ., 1998a) and recently in Peru (Gutierrez et al ., 2003), whereas SPCSV‐WA is known from Egypt, Israel, Nigeria, Niger, Spain, Peru and the United States (Carey et al ., 1999; Fenby et al ., 2002; Gutierrez et al ., 2003; IsHak et al ., 2003; Valverde et al ., 2004). The strain of SPCSV detected serologically in sweetpotato germplasm in Indonesia was not determined (Carey et al ., 1999).…”

“…A fragment of ∼1.8 kb comprising part of the replicase (NIb) encoding region and the whole CP and 3′‐UTR was PCR‐amplified from the SPFMV and SPMMV isolates using the degenerate (forward) primer PVD‐1 (Gibbs and MacKenzie, 1997) and the reverse primer FM10820 (5′‐GGCTCGATCACGAAACCAAAA‐3′), which we designed, or a poly(T) primer, respectively. A specific forward primer SPVC‐CP195 (5′‐ATGCGCTCTGTTTCACC‐3′) was designed and used with the reverse primer FM10820 for cloning of SPFMV strain C. For SPCSV, cDNA was synthesized with the reverse primer CL43L designed according to the Hsp70h genes of SPCSV‐WA and SPCSV‐EA (IsHak et al ., 2003). A 446‐nt fragment of the Hsp70h gene was amplified using the forward primer CL43U and reverse primer CL43L (IsHak et al ., 2003).…”

“…A 446‐nt fragment of the Hsp70h gene was amplified using the forward primer CL43U and reverse primer CL43L (IsHak et al ., 2003). Sequence alignments, comparisons and phylogenetic analyses were as described by IsHak et al . (2003).…”

Yellow vein‐affected blackberries and the presence of a novel Crinivirus

“…Closteroviruses exhibit considerable variability (D’Urso et al ., 2003; IsHak et al ., 2003; Sambade et al ., 2003; Theilmann et al ., 2004) and appear to be able to maintain indel mutations as shown for Beet pseudo yellows virus (Tzanetakis & Martin, 2004b). The lack of diversity of the BYVaV sequenced regions, also observed in a few other members of the family (Offei et al ., 2004; Marco & Aranda, 2005; Turturo et al ., 2005), may be characteristic of this virus or it may be due to the relatively recent emergence of the virus in the USA.…”