Some properties of human small heat shock protein Hsp20 (HspB6)

Abstract

Human heat shock protein of apparent molecular mass 20 kDa (Hsp20) and its mutant, S16D, mimicking phosphorylation by cyclic nucleotide-dependent protein kinases, were cloned and expressed in Escherichia coli. The proteins were obtained in a homogeneous state without utilization of urea or detergents. On size exclusion chromatography at neutral pH, Hsp20 and its S16D mutant were eluted as symmetrical peaks with an apparent molecular mass of 55-60 kDa. Chemical crosslinking resulted in the formation of dimers with an apparent molecular mass of 42 kDa. At pH 6.0, Hsp20 and its S16D mutant dissociated, and were eluted in the form of two peaks with apparent molecular mass values of 45-50 and 28-30 kDa. At pH 7.0-7.5, the chaperone activity of Hsp20 (measured by its ability to prevent the reduction-induced aggregation of insulin or heat-induced aggregation of yeast alcohol dehydrogenase) was similar to or higher than that of commercial a-crystallin. Under these conditions, the S16D mutant of Hsp20 possessed lower chaperone activity than the wild-type protein. At pH 6.0, both a-crystallin and Hsp20 interacted with denatured alcohol dehydrogenase; however, a-crystallin prevented, whereas Hsp20 either did not affect or promoted, the heat-induced aggregation of alcohol dehydrogenase. The mixing of wild-type human Hsp27 and Hsp20 resulted in a slow, temperaturedependent formation of hetero-oligomeric complexes, with apparent molecular mass values of 100 and 300 kDa, which contained approximately equal amounts of Hsp27 and Hsp20 subunits. Phosphorylation of Hsp27 by mitogen activated protein kinase-activated protein kinase 2 was mimicked by replacing Ser15, 78 and 82 with Asp. A 3D mutant of Hsp27 mixed with Hsp20 rapidly formed a hetero-oligomeric complex with an apparent molecular mass of 100 kDa, containing approximately equal quantities of two small heat shock proteins.Keywords: small heat shock proteins; phosphorylation; chaperone activity.Human small heat shock proteins (sHsp) form a large group of proteins, consisting of 10 members with a molecular mass in the range of 17-23 kDa [1]. These proteins are grouped together because all contain an a-crystallin domain, of 80-100 amino acid residues, which is located in the C-terminal part of the protein [2,3]. Some sHsp, such as aB-crystallin and Hsp27, are ubiquitous and expressed in practically all tissues [1,2,4,5], whereas other sHsp (such as HspB7 and HspB9) are expressed only in specific tissues [1,4,5]. sHsp tend to form large oligomers that vary in structure and number of monomers [6,7]. These complexes can be formed by identical or nonidentical subunits. Subunits of a-crystallin, Hsp20, Hsp22, and Hsp27 seem to be involved in the formation of different heterooligomeric complexes [8][9][10][11][12]. Hsp27 and aB-crystallin have been analyzed in detail [2-5,13,14], whereas other members of the large superfamily of sHsp are less well characterized.Hsp20 was described by Kato et al.[8] as a byproduct of purification of human aB-crystallin and Hsp27. Hsp20 is expressed...

The pivotal role of the β7 strand in the intersubunit contacts of different human small heat shock proteins

“…As reported earlier (Bukach et al 2003), the wild-type HspB6 was eluted as a single symmetric peak with an apparent molecular mass of 53-57 kDa probably corresponding to dimer. The elution volume was independent of the quantity of protein loaded on the column (Fig.…”

“…As reported earlier, oxidation of the wild-type HspB6 containing the single Cys46, is accompanied by accumulation of crosslinked dimers with an apparent molecular mass of about 43 kDa (Bukach et al 2003). The Cys-mutant of HspB6 containing the single Cys116 was easily oxidized with the formation of a crosslinked dimers with an apparent molecular mass 43 kDa (Fig.…”

“…1a). By using earlier described methods (Kasakov et al 2007;Bukach et al 2003) and procedure described in the "Materials and methods" section we purified the wildtype human αB-crystallin, HspB6 and HspB8, and their Cys-mutants (Fig. 1b) and found that the mutations introduced do not affect the electrophoretic mobility of these proteins in SDS-gel electrophoresis.…”

“…Recombinant wild-type untagged human HspB6, HspB8 and HspB1 were expressed and purified as described earlier (Kasakov et al 2007;Bukach et al 2003). The full-length cDNA of αB-crystallin was amplified from MarathonReady Brain cDNA (Clontech) using the following forward GAGATATACAT ATGGACATCGCCATCCACCACC and reverse ATTGCTCGAGCTATTTCTTGGGGGC TGCGGT GACAG primers containing NdeI and XhoI restriction sites (underlined) and Pfx Platinum DNA polymerase (Invitrogen).…”

The Small Heat Shock Protein IbpA of Escherichia coli Cooperates with IbpB in Stabilization of Thermally Aggregated Proteins in a Disaggregation Competent State

“…Formation of heterooligomeric sHsp complexes was previously reported for the same class of sHsps isolated from Bradyrhizobium japonicum (34), closely related ␣A-and ␣B-crystallins (44), Hsp27 and ␣B-crystallin (45), and human Hsp20 and Hsp27 (46). The studies performed for B. japonicum sHsps reveal that heterooligomers display chaperone activities indistinguishable from homooligomeric complexes (34).…”