2004
DOI: 10.4049/jimmunol.173.2.1033
|View full text |Cite
|
Sign up to set email alerts
|

Specific Engagement of TLR4 or TLR3 Does Not Lead to IFN-β-Mediated Innate Signal Amplification and STAT1 Phosphorylation in Resident Murine Alveolar Macrophages

Abstract: The innate immune response must be mobilized promptly yet judiciously via TLRs to protect the lungs against pathogens. Stimulation of murine peritoneal macrophage (PMφ) TLR4 or TLR3 by pathogen-associated molecular patterns (PAMPs) typically induces type I IFN-β, leading to autocrine activation of the transcription factor STAT1. Because it is unknown whether STAT1 plays a similar role in the lungs, we studied the response of resident alveolar macrophages (AMφ) or control PMφ from normal C57BL/6 mice to stimula… Show more

Help me understand this report

Search citation statements

Order By: Relevance

Paper Sections

Select...
3
1
1

Citation Types

4
46
0

Year Published

2005
2005
2015
2015

Publication Types

Select...
6
2
1

Relationship

0
9

Authors

Journals

citations
Cited by 55 publications
(50 citation statements)
references
References 63 publications
4
46
0
Order By: Relevance
“…14 Recent evidence indicates that type I IFN is induced by the signaling of TLR-3 (a receptor for dsRNA and polyriboinosinic polyribocytidylic acid (poly I:C)), TLR-4 (a receptor for lipopolysaccharide (LPS)), TLR-7 (a receptor for single-stranded RNA) and TLR-9 (a receptor for CpG DNA) in macrophage and DCs. 14,[35][36][37] Our data indicate that steady-state levels of TLR-3 and TLR-9 mRNAs are higher in the portal tract of PBC liver samples than in samples from AIH and CHC patients (Figure 2c), while TLR-3, -4 and -7 mRNA levels were higher in the PBC liver parenchyma than in AIH and CHC (Figure 2d). In both portal tract and liver parenchyma, there was a strong positive correlation between steady-state mRNA levels of TLR-3 and type I IFN (Figure 3).…”
Section: Discussionmentioning
confidence: 74%
“…14 Recent evidence indicates that type I IFN is induced by the signaling of TLR-3 (a receptor for dsRNA and polyriboinosinic polyribocytidylic acid (poly I:C)), TLR-4 (a receptor for lipopolysaccharide (LPS)), TLR-7 (a receptor for single-stranded RNA) and TLR-9 (a receptor for CpG DNA) in macrophage and DCs. 14,[35][36][37] Our data indicate that steady-state levels of TLR-3 and TLR-9 mRNAs are higher in the portal tract of PBC liver samples than in samples from AIH and CHC patients (Figure 2c), while TLR-3, -4 and -7 mRNA levels were higher in the PBC liver parenchyma than in AIH and CHC (Figure 2d). In both portal tract and liver parenchyma, there was a strong positive correlation between steady-state mRNA levels of TLR-3 and type I IFN (Figure 3).…”
Section: Discussionmentioning
confidence: 74%
“…In our investigation, 2 weeks of daily DT exposure reproducibly induced pulmonary fibrosis. The 10-mg/kg dose of DT is in the range of what others have used in studies to ablate podocytes (20) and to specifically target neurons (23), hepatocytes (15), osteocytes (23), and monocytes/macrophages (21). A significantly higher dose (5,000 mg/kg) was used to ablate cardiomyocytes (24).…”
Section: Discussionmentioning
confidence: 99%
“…The total RNA was reverse transcribed to cDNA, and specific PCR products were generated using Brilliant SYBR Green RT-PCR master mix kit, 1 step (Stratagene), as per the manufacturer's instructions. cDNA conversion, amplification, and data analysis were performed using the Mx3000P real-time PCR system computerized cycler (Stratagene) as previously described (20). We used the following primers that were selected using software available at http://labtools.strategene.com and were synthesized and HPLC purified (Invitrogen Life Technologies): DTR (upper primer: 59-GGAATCGGCTGG-GGACTGCTACCTCTGA-39; lower primer: 59-AGTTCAGCGTGTC-CGGCGAGGGCGAGG-39; product size 239 bp), SPC (upper primer: CATCGTTGTGTATGACTACCA; lower primer: CCTGAAGTTCTGGAGTTTTCT; product size 130 bp), and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (upper primer: TATGTCGTGGAGTCTACTGGT; lower primer: GAGTTGTC ATATTTCTCGTGG; product size 149 bp).…”
Section: Lung Histologymentioning
confidence: 99%
“…cDNA was prepared using Brilliant SYBR Green QRT-PCR mastermix kit, 1 step (Stratagene). Amplification and data analysis were performed using an Mx3000P real-time PCR system computerized cycler from Stratagene, as previously described (29). Primer sequences for murine ICAM-1 amplification included the following primer pairs: 51 (5Ј-CGG CTG GAC GAG ACG GAC TGC-3Ј) and 31 (5Ј-AGA GGA AGT GGC TGA GGG TAA ATG-3Ј); 52 (5Ј-CAT CGG GGT GGT GAA xGTC TGT C-3Ј) and 32 (5Ј-TGC TGT CTA CCA TTC TGT TCA AAA-3Ј); and 52 paired with 33 (5Ј-CAC GAG GCC CAC AAT GAC CAG CAG TA-3Ј) (see Fig.…”
Section: Methodsmentioning
confidence: 99%