Specific interaction of TFII‐I with an upstream element on the HIV‐1 LTR regulates induction of latent provirus

Malcolm, Tom; Kam, Joanna; Pour, Pouya Sadeghi; Sadowski, Ivan

doi:10.1016/j.febslet.2008.10.032

Cited by 28 publications

(69 citation statements)

References 16 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…TFII-I is a multifunctional transcription factor that plays an important role in transcription of HIV-1 genes in activated T cells (14). Here we demonstrate for the first time that the TFII-I gene contains functional sterol response elements and that expression of the TFII-I protein is controlled by SREBP2.…”

mentioning

confidence: 70%

“…TFII-I has been reported to bind and transactivate the HIV-1 LTR (14). To confirm that TFII-I enhances HIV-1 replication at the level of transcription, resting primary CD4 ϩ T cells were cotransfected with a TFII-I expression vector and reporter construct containing the HIV-1 LTR driving expression of enhanced green fluorescent protein (EGFP) (Fig.…”

Section: Hiv-1 Infection Induces Tfii-i Expression In Cd4mentioning

confidence: 99%

See 1 more Smart Citation

Sterol Regulatory Element-Binding Protein 2 Couples HIV-1 Transcription to Cholesterol Homeostasis and T Cell Activation

Taylor

Linde

Khatua

et al. 2011

J Virol

View full text Add to dashboard Cite

mentioning

confidence: 70%

Section: Hiv-1 Infection Induces Tfii-i Expression In Cd4mentioning

confidence: 99%

Sterol Regulatory Element-Binding Protein 2 Couples HIV-1 Transcription to Cholesterol Homeostasis and T Cell Activation

Taylor

Linde

Khatua

et al. 2011

J Virol

View full text Add to dashboard Cite

“…Phosphopeptides from in vitro-phosphorylated S92 and S92F Phd1 were analyzed as described previously (22), except that the proteins were digested overnight with trypsin or both trypsin and chymotrypsin (Roche Diagnostics). DNase I footprinting reactions were performed as described previously (30), using recombinant Ste12 protein produced in insect cells (41) and a 1-kb PHD1 promoter template fragment excised from plasmid pJP025.…”

Section: Methodsmentioning

confidence: 99%

Cdk8 Regulates Stability of the Transcription Factor Phd1 To Control Pseudohyphal Differentiation of Saccharomyces cerevisiae

Raithatha

Lourenco

et al. 2012

Molecular and Cellular Biology

Self Cite

View full text Add to dashboard Cite

The yeast Saccharomyces differentiates into filamentous pseudohyphae when exposed to a poor source of nitrogen in a process involving a collection of transcription factors regulated by nutrient signaling pathways. Phd1 is important for this process in that it regulates expression of most other transcription factors involved in differentiation and can induce filamentation on its own when overproduced. In this article, we show that Phd1 is an unstable protein whose degradation is initiated through phosphorylation by Cdk8 of the RNA polymerase II mediator subcomplex. Phd1 is stabilized by cdk8 disruption, and the naturally filamenting ⌺1278b strain was found to have a sequence polymorphism that eliminates a Cdk8 phosphorylation site, which both stabilizes the protein and contributes to enhanced differentiation. In nitrogen-starved cells, PHD1 expression is upregulated and the Phd1 protein becomes stabilized, which causes its accumulation during differentiation. PHD1 expression is partially dependent upon Ste12, which was also previously shown to be destabilized by Cdk8-dependent phosphorylations, but to a significantly smaller extent than Phd1. These observations demonstrate the central role that Cdk8 plays in initiation of differentiation. Cdk8 activity is inhibited in cells shifted to limiting nutrient conditions, and we argue that this effect drives the initiation of differentiation through stabilization of multiple transcription factors, including Phd1, that cause activation of genes necessary for filamentous response.

show abstract

“…VSV pseudotyped pTY-LAI-luc virus was produced by co-transfection of Human embryonic kidney (HEK) 293T cells (ATCC) as previously described [14]. Infected Jurkat-tat (NIH-AIDS) cells were monitored for eGFP expression and clones isolated by FACS.…”

Section: Cell Lines Transfections and Cell Culturementioning

confidence: 99%

“…ChIP assays were performed with antibodies from Abcam according to the suppliers instructions, and assayed by qPCR using oligos specific for the HIV-1 LTR core promoter (P1: AGTGGCGAGCCCTC-AGAT, and P2: AGAGCTCCCAGGCTCAAATC). Results for NFjB p65 and TBP are normalized to controls using oligos specific for GAPDH [14], and for reactions with anti-H3K9trimethylation and acetylation to controls for total histone H3.…”

Section: Chip Assaysmentioning

confidence: 99%

The Suv39H1 methyltransferase inhibitor chaetocin causes induction of integrated HIV-1 without producing a T cell response

et al. 2011

Self Cite

View full text Add to dashboard Cite

Edited by Hans-Dieter KlenkKeywords: HIV-1 Latency Chaetocin SUV39H1 HDAC inhibitor a b s t r a c t Latent HIV-1 (human immunodeficiency virus-1) provirus is unaffected by current AIDS (acquired immunodeficiency syndrome) therapies. We show here that chaetocin, an SUV39H1 histone methyltransferase inhibitor, causes 25-fold induction of latent HIV-1 expression, while producing minimal toxicity and without causing T cell activation. Induction is associated with loss of histone H3 lysine 9 (H3K9) trimethylation at the long terminal repeat (LTR) promoter, and a corresponding increase in H3K9 acetylation. The effect of chaetocin is amplified synergistically in combination with histone deacetylase (HDAC) inhibitors. These results indicate that chaetocin may provide a therapy to purge cells of latent HIV-1, possibly in combination with other chromatin remodeling drugs. Crown

show abstract

Specific interaction of TFII‐I with an upstream element on the HIV‐1 LTR regulates induction of latent provirus

Cited by 28 publications

References 16 publications

Sterol Regulatory Element-Binding Protein 2 Couples HIV-1 Transcription to Cholesterol Homeostasis and T Cell Activation

Sterol Regulatory Element-Binding Protein 2 Couples HIV-1 Transcription to Cholesterol Homeostasis and T Cell Activation

Cdk8 Regulates Stability of the Transcription Factor Phd1 To Control Pseudohyphal Differentiation of Saccharomyces cerevisiae

The Suv39H1 methyltransferase inhibitor chaetocin causes induction of integrated HIV-1 without producing a T cell response

Contact Info

Product

Resources

About