SPX-related genes regulate phosphorus homeostasis in the marine phytoplankton, Phaeodactylum tricornutum

Abstract

Phosphorus (P) is an essential nutrient for marine phytoplankton. Maintaining intracellular P homeostasis against environmental P variability is critical for phytoplankton, but how they achieve this is poorly understood. Here we identify a SPX gene and investigate its role in Phaeodactylum tricornutum. SPX knockout led to significant increases in the expression of phosphate transporters, alkaline phosphatases (the P acquisition machinery) and phospholipid hydrolases (a mechanism to reduce P demand). These demonstrate that SPX is a negative regulator of both P uptake and P-stress responses. Furthermore, we show that SPX regulation of P uptake and metabolism involves a phosphate starvation response regulator (PHR) as an intermediate. Additionally, we find the SPX related genes exist and operate across the phytoplankton phylogenetic spectrum and in the global oceans, indicating its universal importance in marine phytoplankton. This study lays a foundation for better understanding phytoplankton adaptation to P variability in the future changing oceans.

Complementary environmental analysis and functional characterization of a plastid diatom lower glycolytic-gluconeogenesis pathway

“…4B, S17). We did not observe consistent differences in the expression of nitrogen or phosphorus stress metabolism in knockout lines compared to controls, suggesting that these difference do not relate to difference in N or P limitation between knockout and the faster-growing control lines under 19C CL conditions (Table S5, sheets 4-5) (59,104,106). These changes are supported by the greater absorption cross-section σPSII identified in photo-physiological analyses, but do not appear to impact substantially on measured Fv/ Fm (Figs.…”

Trypsin is a coordinate regulator of N and P nutrients in marine phytoplankton

“…However, much of the mechanics in the regulatory cascade, from environmental nutrient sensing, PtTryp2- mediated signaling, to the regulation of the effectors such as N- and Pi-transporters and assimilatory genes, remains to be elucidated. Although the interplay between N and P nutrition based on SPX-NLP-NIGT1 and SPX-PHR-NIGT1 cascades, respectively have been uncovered in plants 12 , 19 , how PtTryp2 interacts with the SPX-PHR cascade 26 and whether a SPX-NLP cascade or other regulatory cascades exist and interact with PtTryp2 for P and N nutrient regulation in phytoplankton remain to be addressed.…”

“…Gene co-expression network analysis. The integrative transcriptomic data comprise 94 samples across different nitrogen and phosphorus conditions were retrieved from this study and published studies 26,36,60 . The expression data were analyzed by the Inferelator algorithm 27 to identify regulatory networks that could emerge from PtTryp2.…”

Functional differentiation and complementation of alkaline phosphatases and choreography of DOP scavenging in a marine diatom

“…Single guide RNAs (sgRNAs) were designed specifically for PhoA (5’‐GAAGAGCAGTGGAGGTGAGG‐3’) and PhoD_45757 (5’‐GATACTTCGCGTTCTCCCTT‐3’). The sgRNA adapters were individually ligated into separate pKS_diaCas9_sgRNA plasmids (Addgene ID: 74923) following a previously reported protocol (Nymark et al, 2017; Zhang et al, 2021). The solo pKS_diaCas9 plasmid was used as the blank control (Cas9‐C).…”