Structural cues involved in endoplasmic reticulum degradation of G85E and G91R mutant cystic fibrosis transmembrane conductance regulator.

Abstract

Abnormal folding of mutant cystic fibrosis transmembrane conductance regulator (CFTR) and subsequent degradation in the endoplasmic reticulum is the basis for most cases of cystic fibrosis. Structural differences between wild-type (WT) and mutant proteins, however, remain unknown. Here we examine the intracellular trafficking, degradation, and transmembrane topology of two mutant CFTR proteins, G85E and G91R, each of which contains an additional charged residue within the first putative transmembrane helix (TM1). In microinjected Xenopus laevis oocytes, these mutations markedly disrupted CFTR plasma membrane chloride channel activity. G85E and G91R mutants (but not a conservative mutant, G91A) failed to acquire complex N -linked carbohydrates, and were rapidly degraded before reaching the Golgi complex thus exhibiting a trafficking phenotype similar to ⌬ F508 CFTR. Topologic analysis revealed that neither G85E nor G91R mutations disrupted CFTR NH 2 terminus transmembrane topology. Instead, WT as well as mutant TM1 spanned the membrane in the predicted C-trans (type II) orientation, and residues 85E and 91R were localized within or adjacent to the plane of the lipid bilayer. To understand how these charged residues might provide structural cues for ER degradation, we examined the stability of WT, G85E, and G91R CFTR proteins truncated at codons 188, 393, 589, or 836 (after TM2, TM6, the first nucleotide binding domain, or the R domain, respectively). These results indicated that G85E and G91R mutations affected CFTR folding, not by gross disruption of transmembrane assembly, but rather through insertion of a charged residue within the plane of the bilayer, which in turn influenced higher order tertiary structure. ( J. Clin. Invest. 1997.

Sulfonylureas Correct Trafficking Defects of ATP-sensitive Potassium Channels Caused by Mutations in the Sulfonylurea Receptor

“…However, the first transmembrane domain (TM0) where the A116P and V187D mutations are located has not been implicated in glibenclamide binding. Interestingly, in the cystic fibrosis transmembrane conductance regulator, some mutations in the first transmembrane domain prevent proper folding of the full-length protein not by disrupting folding of the first transmembrane itself but by affecting how this domain interacts with downstream domains (54). It is possible that the two TM0 mutations also destabilize the folding of the downstream domains, which can be stabilized by binding of sulfonylureas.…”

Cooperativity and Flexibility of Cystic Fibrosis Transmembrane Conductance Regulator Transmembrane Segments Participate in Membrane Localization of a Charged Residue

“…Fragments were digested with HindIII (in SP64 polylinker) and BstEII (in antisense oligonucleotide) and ligated into HindIII/BstEII digested vector S.L.ST.gG.P (4,19 , respectively, followed by the C-terminal 142 residues of bovine prolactin. Plasmids TM1.P and TM2.P are described elsewhere (14,35). Plasmids TM7, TM7-8, TM7-9, TM7-10, TM7-11, and TM7-12 were generated by amplifying CFTR codons Glu 838 , AGCTTTGGTCACCAGAGTTTCAAAGTA-AGG (TM7-10) , GATAATGGTCACCCTTCCTTCTCCTTCTCCTG , and GCCCCCGGTCACCCAGATGTCATCTTTCTT .…”

Assembly and Misassembly of Cystic Fibrosis Transmembrane Conductance Regulator: Folding Defects Caused by Deletion of F508 Occur Before and After the Calnexin-dependent Association of Membrane Spanning Domain (MSD) 1 and MSD2

“…To test this model, we took advantage of the observation that split CFTR fragments that individually contain the N-and C-terminal subdomains assemble into an ion channel when expressed in trans (Chan et al, 2000). Nterminal CFTR fragments containing MSD1, NBD1, and the R domain fold to a conformation that has a long half-life and accumulates at high levels when expressed alone or in trans with CFTR 837-1480 (Ostedgaard et al, 1997;Xiong et al, 1997;Meacham et al, 1999). However, when CFTR 837-1480 is expressed alone it accumulates at low levels as an immaturely glycosylated species ( Figure 4A).…”

“…We next compared the trypsin proteolysis patterns of misfolded CFTR from CAS-treated cells with the patterns observed from CFTR⌬F508, CFTRG91R, and CFTR N1303K, which contain mutations localized to the NBD1, MSD1, and NBD2 domains, respectively (Osborne et al, 1992;Xiong et al, 1997). Similar to what we observed upon CAS treatment, the sizes of the N-terminal fragments produced by trypsin digestion of the CFTR⌬F508 and CFTRG91R mutants did not change significantly, but a significant increase in the sensitivity of the 40-kDa fragment to digestion by 25 g/ml trypsin was observed ( Figure 6B).…”