Structural organization of a Bacillus subtilis operon encoding menaquinone biosynthetic enzymes

Rowland, Belinda; Hill, Kevin; Miller, Paul; Driscoll, Jeffrey; Taber, Harry

doi:10.1016/0378-1119(95)00662-1

Cited by 18 publications

(13 citation statements)

References 18 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…(3,20). At men locus, the locations of the menF, menD, open reading frame 3 (ORF3), menB, and menE genes are indicated (3,21,26 and 5% ␣-naphthol (Fluka) (0.2 ml) in a 2.5 N NaOH solution were added to 1 ml of culture supernatant or diluted supernatant containing between 0.01 and 0.25 mM acetoin. The A 540 was allowed to develop at room temperature for 60 min, at which time the color intensity was at its maximum.…”

Section: Methodsmentioning

confidence: 99%

“…At the oxidative metabolic stage, coordination of TCA cycle activity with the formation of respiratory chain components, especially MK, is essential for utilization of nonfermentable carbon sources. Most B. subtilis structural genes encoding biosynthesis of the naphthoquinone ring of MK have been isolated (3,21,26,33). The enzymology of MK biosynthesis is understood, and geneenzyme relationships have been established (3,21,23).…”

mentioning

confidence: 99%

See 1 more Smart Citation

Transcriptional regulation of the Bacillus subtilis menp1 promoter

Xuan

Taber

1996

J Bacteriol

View full text Add to dashboard Cite

The Bacillus subtilis men genes encode biosynthetic enzymes for formation of the respiratory chain component menaquinone. The menp1 promoter previously was shown to be the primary cis element for menFD gene expression. In the present work, it was found that either supplementation with nonfermentable carbon sources or reutilization of glycolytic end products increased menp1 activity in the late postexponential phase. The effect on menp1 activity by a particular end product (such as acetoin or acetate) was prevented by blocking the corresponding pathway for end product utilization. Alteration of a TGAAA motif within the promoter region resulted in unregulated menp1 activity throughout the culture cycle, irrespective of the carbon source added.

show abstract

Section: Methodsmentioning

confidence: 99%

mentioning

confidence: 99%

Transcriptional regulation of the Bacillus subtilis menp1 promoter

Xuan

Taber

1996

J Bacteriol

View full text Add to dashboard Cite

show abstract

“…In-frame deletions of menF and dhbC were constructed in vitro. Plasmid pAI112 carries a 540-bp HindIII-PvuII deletion within menF that was constructed as follows: plasmid pAI46 (21) was digested with SalI, treated with Klenow, digested with SacI, and ligated with the 1-kbp SacI-PvuII fragment of plasmid pAI79 (30). Plasmid pAI166 carries a fragment with a 980-bp deletion within dhbC that was generated by the technique of overlap extension PCR (10) with linear pENT4 as the template and the four synthetic oligonucleotides d1 (5Ј GAAACAGACATGCAGTGG), d2 (5Ј CCG CAGCATTGTCCGAAACTCTGCAATTCGGCCAGAAAGG), d3 (5Ј CCTT TCTGGCCGAATTGCAGAGTTTCGGACAATGCTGCGG), and d4 (5Ј AG GAAATGCGTCATCTGG).…”

Section: Methodsmentioning

confidence: 99%

“…subtilis has two distinct isochorismate synthases encoded by the menF (30) and dhbC (29) genes. MenF and DhbC are 47% identical at the DNA level and have 35% amino acid identity (29).…”

mentioning

confidence: 99%

See 1 more Smart Citation

Duplicate isochorismate synthase genes of Bacillus subtilis: regulation and involvement in the biosyntheses of menaquinone and 2,3-dihydroxybenzoate

Rowland

Taber

1996

J Bacteriol

View full text Add to dashboard Cite

Bacillus subtilis has duplicate isochorismate synthase genes, menF and dhbC. Isochorismate synthase is involved in the biosynthesis of both the respiratory chain component menaquinone (MK) and the siderophore 2,3-dihydroxybenzoate (DHB). Several menF and dhbC deletion mutants were constructed to identify the contribution made by each gene product to MK and DHB biosynthesis. menF deletion mutants were able to produce wild-type levels of MK and DHB, suggesting that the dhbC gene product is able to compensate for the lack of MenF. However, a dhbC deletion mutant produced wild-type levels of MK but was DHB deficient, indicating that MenF is unable to compensate for the lack of DhbC. A menF dhbC double-deletion mutant was both MK and DHB deficient. Transcription analysis showed that expression of dhbC, but not of menF, is regulated by iron concentration. A dhbA::lacZ fusion strain was constructed to examine the effects of mutations to the iron box sequence within the dhb promoter region. These mutations abolished the iron-regulated transcription of the dhb genes, suggesting that a Fur-like repressor protein exists in B. subtilis.Isochorismate synthase is responsible for converting chorismate to isochorismate and is necessary for the biosynthesis of both the respiratory chain component menaquinone (MK) and the Bacillus subtilis siderophore 2,3-dihydroxybenzoate (DHB) (Fig. 1). Although it is known that the carbon source, growth phase, and oxygen tension have regulatory effects, the actual signals that induce expression of respiratory chain components are unknown (37). However, the production of DHB is known to be regulated by iron concentration (1,25,26). Therefore, isochorismate is required by cells under very different environmental conditions.B. subtilis has two distinct isochorismate synthases encoded by the menF (30) and dhbC (29) genes. MenF and DhbC are 47% identical at the DNA level and have 35% amino acid identity (29). menF is a promoter-proximal gene of the MK biosynthetic gene cluster located at 273Њ on the chromosome (30,38). MK is a lipophilic, nonprotein redox component mediating electron transfer between dehydrogenases and cytochromes (37). dhbC is the second gene of the DHB biosynthetic gene cluster located at 291Њ on the chromosome (29). Under conditions of iron deprivation, B. subtilis synthesizes DHB, a component of the specific transport system for the uptake of extracellular iron (1,25,26). This is not the only instance of gene duplication in B. subtilis. There are two thymidylate synthetases, TSaseA and TSaseB, that are encoded by the unlinked thyA and thyB genes, respectively (22). Both enzymes are functional in bacteria grown at 37ЊC or lower temperatures, but only TSaseA is active at 46ЊC (22). There are two different a-type terminal oxidases in B. subtilis that are encoded by separate loci (32). One of the oxidases is associated with a heme C-containing unit (32). The two membrane alkaline phosphatases of B. subtilis have substantial differences with respect to molecular weight, substrate sp...

show abstract

Development of menaquinone-7 enriched nutraceutical: inside into medium engineering and process modeling

2014

View full text Add to dashboard Cite

Menaquinone 7 (MK-7) is nutritionally important metabolite found by fermentation mainly using B. subtilis species. In this study, soybean medium was modified to improve the MK-7 production using Bacillus subtilis NCIM 2708 under solid state fermentation. The objective of this study was to produce large amount of MK-7 within a short period of time. Nine nutritional components viz. glycerol, mannitol, dextrose, sucrose, yeast extract, malt extract, K 2 HPO 4 , MgSO 4 .7H 2 O and CaCl 2 were investigated to obtain the maximum MK-7 concentration. The highest MK-7 concentration 39.039 μg/g was obtained after 24 h of fermentation in the following optimised medium components: soybean 20 g, glycerol 40 ml/kg, mannitol 60 g/kg, yeast extract 4 g/kg, malt extract 8 g/kg and calcium chloride 4 g/kg. The maximum production of MK-7 56.757 μg/g was predicted by point prediction tool of Design Expert 7.1 software (Statease Inc. USA). This data shows 68.78 % validity of the predicted model.

show abstract

Structural organization of a Bacillus subtilis operon encoding menaquinone biosynthetic enzymes

Cited by 18 publications

References 18 publications

Transcriptional regulation of the Bacillus subtilis menp1 promoter

Transcriptional regulation of the Bacillus subtilis menp1 promoter

Duplicate isochorismate synthase genes of Bacillus subtilis: regulation and involvement in the biosyntheses of menaquinone and 2,3-dihydroxybenzoate

Development of menaquinone-7 enriched nutraceutical: inside into medium engineering and process modeling

Contact Info

Product

Resources

About