Surveillance of Dihydropteroate Synthase Genes in Stenotrophomonas maltophilia by LAMP: Implications for Infection Control and Initial Therapy

Abstract

Stenotrophomonas maltophilia is a common nosocomial pathogen that causes high morbidity and mortality. Because of its inherent extended antibiotic resistance, therapeutic options for S. maltophilia are limited, and sulfamethoxazole/trimethoprim (SXT) is the only first-line antimicrobial recommended. However, with the spread of dihydropteroate synthase (sul1 and sul2) genes, global emergence of SXT resistance has been reported. There is an urgent need to develop a rapid and sensitive but cost-efficient method to monitor the dissemination of sul genes. In this study, we developed loop-mediated isothermal amplification (LAMP) assays for sul1 and sul2 using real-time turbidity and hydroxy naphthol blue coloration methods. The assays could quickly detect sul genes with high sensitivity and specificity. The LAMP detection limit was 0.74 pg/reaction of extracted genomic DNA for sul1 and 2.6 pg/reaction for sul2, which were both 10-fold more sensitive than the corresponding traditional PCR assays. Additionally, the LAMP assays could positively amplify DNA from sul1-producing strains, but not from the negative controls. We then used the LAMP assays to investigate the dissemination of sul genes among S. maltophilia isolates from patients in three hospitals in Beijing, China. Among 450 non-duplicated samples collected during 2012–2014, 56 (12.4%) strains were SXT-resistant. All these SXT-resistant strains were positive for sul genes, with 35 (62.5%) carrying sul1, 17 (30.4%) carrying sul2, and 4 (7.1%) carrying both sul1 and sul2, which indicated that sul genes were the predominant resistance mechanism. Of 394 SXT-susceptible strains, 16 were also sul-positive. To provide epidemiological data for the appropriate choice of antimicrobials for treatment of sul-positive S. maltophilia, we further tested the susceptibility to 18 antimicrobials. Among these, sul-positive strains showed the highest susceptibility to tetracycline derivatives, especially minocycline (MIC50/MIC90, 0.5/4; susceptibility rate, 95.4%). Ticarcillin-clavulanate and new fluoroquinolones (moxifloxacin and levofloxacin) also showed some in vitro activity. Apart from these three kinds of antimicrobials, other agents showed poor activity against sul-positive strains.

In vitro Antibacterial Activity and Resistance Prevention of Antimicrobial Combinations for Dihydropteroate Synthase-Carrying Stenotrophomonas maltophilia

“…The identification of bacterial species was performed using a Vitek II bacterial identification system (bioMérieux, Marcy-l'Étoile, France) and further confirmed via a species-specific polymerase chain reaction. 9,14,15 The detection of the sul genes (including sul1 and sul2 genes) was presented as follows: SUL1-F(GCTATTGGTCTCGGTGTCGC) and SUL1-B(GCATGATCTAACCCTCGGTCT) for sul1; SUL2-F(TTTCGGCATCGTCAACATAA) and SUL2-B(CCACGCGACAAGGCATA) for sul2. The PCR reaction volume system and cycling parameters were the same as in our previously published literature.…”

“…7,8 Our previous epidemiological survey confirmed that the presence of sul genes was the predominant resistance mechanism for SXT in clinically-isolated S. maltophilia in China. 9 S. maltophilia shows high susceptibility to tetracycline derivatives, including minocycline, doxycycline, and tigecycline, and these antimicrobials can be used as alternatives for the treatment of S. maltophilia infection, even for SXT-resistant strains. 1,2,9 However, an in vitro study by Wei et al found that tetracycline derivatives exhibited bacteriostatic activity against S. maltophilia, which can only inhibit the proliferation of S. maltophilia instead of effectively killing the organisms.…”

“…9 S. maltophilia shows high susceptibility to tetracycline derivatives, including minocycline, doxycycline, and tigecycline, and these antimicrobials can be used as alternatives for the treatment of S. maltophilia infection, even for SXT-resistant strains. 1,2,9 However, an in vitro study by Wei et al found that tetracycline derivatives exhibited bacteriostatic activity against S. maltophilia, which can only inhibit the proliferation of S. maltophilia instead of effectively killing the organisms. 10 S. maltophilia infections typically occur in vulnerable, immunocompromised, and critically ill patients, whose immune system is usually impaired and cannot effectively kill pathogens.…”

Frequency and Genetic Determinants of Tigecycline Resistance in Clinically Isolated Stenotrophomonas maltophilia in Beijing, China

“…Treatment of S. maltophilia infections is limited due to the extensive resistance displayed to most clinically used antimicrobials, and sulfamethoxazole/trimethoprim (SXT) is the only recommended first-line antimicrobial. However, its use is limited by a high incidence of allergic reactions, intolerance, and increasing resistance mediated by the spread of sul1 and sul2 genes ( Toleman et al, 2007 ; Hu et al, 2011 ; Chang et al, 2015 ; Zhao et al, 2016 ). Tigecycline has been reported to retain good in vitro activity against S. maltophilia in worldwide surveillance and multicenter studies, and Wei et al (2016) reported that 80.4% of clinical isolates in China, and 72.7% of SXT-resistant isolates were susceptible to tigecycline, making it a promising alternative antimicrobial for infection treatment ( Stein and Babinchak, 2013 ; Rizek et al, 2015 ; Wei et al, 2015 , 2016 ).…”

Quantitative real-time PCR assay for the rapid identification of the multidrug-resistant bacterial pathogen Stenotrophomonas maltophilia

“…S. maltophilia is emerging as an important multidrug-resistant nosocomial pathogen, being amongst the top three most common non-fermentative Gram-negative bacilli identified in hospitalized patients (5, 33). Despite S. maltophilia being well-adapted to many environments, most infections occur in immunocompromised individuals in the nosocomial setting (10), although community-acquired infections are also on the rise (1).…”