Survival and immune response of drones of a Nosemosis tolerant honey bee strain towards N. ceranae infections

Transcriptional signatures of parasitization and markers of colony decline in Varroa-infested honey bees (Apis mellifera)

“…Viral infection has also been found to modulate levels of AMPs in several studies, but the mechanism underlying this effect is very complex and requires further investigations (Danihlík et al, 2015). Immune response F: TGGATGGCAAAGAATTTGGT R: ATTGCAACATTGCCTTAGCC eIF-S8 (Grozinger et al, 2003) Housekeeping gene F: TGAGTGTCTGCTATGGATTGCAA R: TCGCGGCTCGTGGTAAA GAPDH-1 (Huang et al, 2012) Housekeeping gene F: GCTGGTTTCATCGATGGTTT R: ACGATTTCGACCACCGTAAC One differentially expressed gene (GB47805) encodes for a peptidoglycan recognition protein that functions as patternrecognition and effector molecule in innate immunity (Dziarski and Gupta, 2006), while another gene (GB45779) encodes for a UNC93-like protein, which is involved in the innate immune response by regulating Toll-like receptors signalling (Kim et al, 2008). Finally, another DEG (GB42981) encodes a beta1,3-glucan recognition protein that stimulates prophenoloxydase activation and melanization, which is important for wound healing and encapsulation (S€ oderh€ all and Cerenius, 1998).…”

“…Additionally, we monitored expression of vitellogenin (Vg), which was differentially expressed in Experiments 2 and 3; furthermore, Vg has been observed to exhibit significant expression differences in previous studies comparing bees collected from surviving and non-surviving colonies in the field (Dolezal et al, 2016;Smart et al, 2016). Primers were designed using Primer3 (Koressaar and Remm, 2007;Untergasser et al, 2012); elf-S8 (Grozinger et al, 2003) and GAPDH-1 (Huang et al, 2012) were used as housekeeping genes. We confirmed high efficiency amplification of the primers using our qRT-PCR conditions.…”

Pathogen-associated self-medication behavior in the honeybee Apis mellifera

“…To assess the effect of the honey on the infection, freshly emerged workers were individually infected with N. ceranae (10 5 spores per bee) and kept in groups of 100 bees for 6 days following the protocol of Huang et al (2012). The groups were fed ad libitum with the identical honeydew and sunflower honey showing the strongest impact at the previous choice assay.…”

Distribution, epidemiological characteristics and control methods of the pathogen Nosema ceranae Fries in honey bees Apis mellifera L. (Hymenoptera, Apidae)

“…They concluded that treatment by hibernation does not have a significant effect on the attack intensity N. ceranae in the following spring. Huang et al (2012) suggest that it may be possible to select bees which are tolerant to Nosema, and in particular N. ceranae; this line of research might contribute to the management and control of this parasite. Furthermore, replacing the queen is vital for maintaining the homeostasis of a Nosema infected colony; it results in a notable reduction in Nosema infection rates, comparable with that induced by treatment with Fumagillin .…”