Syk Plays a Critical Role in the Expression and Activation of IRAK1 in LPS-Treated Macrophages

Abstract

To address how interleukin-1 receptor-associated kinase 1 (IRAK1) is controlled by other enzymes activated by toll-like receptor (TLR) 4, we investigated the possibility that spleen tyrosine kinase (Syk), a protein tyrosine kinase that is activated at an earlier stage during TLR4 activation, plays a central role in regulating the functional activation of IRAK1. Indeed, we found that overexpression of myeloid differentiation primary response gene 88 (MyD88), an adaptor molecule that drives TLR signaling, induced IRAK1 expression and that piceatannol, a Syk inhibitor, successfully suppressed the MyD88-dependent upregulation of IRAK1 under LPS treatment conditions. Interestingly, in Syk-knockout RAW264.7 cells, IRAK1 activity was almost completely blocked after LPS treatment, while providing a Syk-recovery gene to the knockout cells successfully restored IRAK1 expression. According to our measurements of IRAK1 mRNA levels, the transcriptional upregulation of IRAK1 was induced by LPS treatment between 4 and 60 min, and this can be suppressed in Syk knockout cells, providing an effect similar that that seen under piceatannol treatment. The overexpression of Syk reverses this effect and leads to a significantly higher IRAK1 mRNA level. Collectively, our results strongly suggest that Syk plays a critical role in regulating both the activity and transcriptional level of IRAK1.

MyD88-Syk axis is a critical determinant for inflammatory response in macrophages

“…1B and Fig. S1C) and RAW264.7 cells treated with piceatannol (Pic), a selective Syk inhibitor (Park et al, 2017; Seow et al, 2002), at 10, 20, and 30 min (Fig. 1C).…”

TANK‐binding kinase 1 and Janus kinase 2 play important roles in the regulation of mitogen‐activated protein kinase phosphatase‐1 expression after toll‐like receptor 4 activation

“…One of the STAT3‐targeted sgRNA library sequences (F‐AAGGGCCGGTCCGGGTGCAT; R‐ATGCACCCGGACCGGCCCTT) was chosen and cloned into the PX459 lentiCRISPRv2 vector (plasmid ID #52961; Addgene, Cambridge, MA). Transfection of the plasmids and puromycin (1–3 μg/ml) selection of knockout cells were followed by a previously established protocol in our laboratory (Park et al, ).…”

“…Transfection of the plasmids and puromycin (1-3 μg/ml) selection of knockout cells were followed by a previously established protocol in our laboratory (Park et al, 2017). 2.3 | Cell culture RAW264.7 and HEK293 cells were cultured in RPMI 1640 and DMEM, respectively, supplemented with 10% heat-inactivated FBS and antibiotics (penicillin and streptomycin) and maintained at 37°C in 5% CO 2 . For each experiment, RAW264.7 cells were detached with a cell scraper, whereas HEK293 cells were harvested by trypsinization.…”

“…Soluble cell lysates were used for immunoblotting. The total and phosphorylated levels of MKP1, p38, JNK, ERK, c-Jun, JAK2, STAT1, STAT3, STAT5, and β-actin were visualized, as described previously (Park et al, 2011).…”

Regulation of 8-Hydroxydaidzein in IRF3-Mediated Gene Expression in LPS-Stimulated Murine Macrophages

“…RAW264.7 cells (2.5 × 10 6 cell/mL) were pre-incubated overnight, followed by pre-treatment with 8-HD (50 µM) for 30 min, then the cells were incubated with LPS (1 µg/mL) for 30, 60, 90, and 120 min. Both cell types were harvested at the end of the incubation as indicated, and whole-cell lysates were prepared as described previously [24]. For nuclear fraction preparation, RAW264.7 cells (5 × 10 6 cell/mL) were pre-incubated overnight, followed by pre-treatment with 8-HD (50 µM) for 30 min and an additional 30 min incubation with LPS (1 µg/mL).…”