Synergistic Effects of Sulfated Polysaccharides from Mexican Seaweeds against Measles Virus

Abstract

Sulfated polysaccharides (SPs) extracted from five seaweed samples collected or cultivated in Mexico (Macrocystis pyrifera, Eisenia arborea, Pelvetia compressa, Ulva intestinalis, and Solieria filiformis) were tested in this study in order to evaluate their effect on measles virus in vitro. All polysaccharides showed antiviral activity (as measured by the reduction of syncytia formation) and low cytotoxicity (MTT assay) at inhibitory concentrations. SPs from Eisenia arborea and Solieria filiformis showed the highest antiviral activities (confirmed by qPCR) and were selected to determine their combined effect. Their synergistic effect was observed at low concentrations (0.0274 μg/mL and 0.011 μg/mL of E. arborea and S. filiformis SPs, resp.), which exhibited by far a higher inhibitory effect (96% syncytia reduction) in comparison to the individual SP effects (50% inhibition with 0.275 μg/mL and 0.985 μg/mL of E. arborea and S. filiformis, resp.). Time of addition experiments and viral penetration assays suggest that best activities of these SPs occur at different stages of infection. The synergistic effect would allow reducing the treatment dose and toxicity and minimizing or delaying the induction of antiviral resistance; sulfated polysaccharides of the tested seaweed species thus appear as promising candidates for the development of natural antiviral agents.

Virucidal and Synergistic Activity of Polyphenol-Rich Extracts of Seaweeds against Measles Virus

“…Five species of Mexican macroalgae were used in this study, three from Baja California ( Macrocystis pyrifera , Ecklonia arborea (formerly Eisenia arborea ), and Silvetia compressa (formerly Pelvetia compressa ), one green seaweed from Southern Baja California ( Ulva intestinalis ), and one red seaweed from Yucatan ( Solieria filiformis ). In a previous study, our group reported in detail the collection of these five seaweeds [ 13 ].…”

“…In the present study, we tested the antiviral activity in vitro against MeV of Polyphenol-rich extracts isolated from five Mexican seaweeds. We tested the combined antiviral effect of the best polyphenols with ribavirin and with sulphated polysaccharides isolated from the same seaweeds with potent antiviral properties [ 13 ]. The main goal of this research was to discover new candidates of antiviral drugs with a low cytotoxicity and affordable cost of production that could help control viral infection diseases.…”

The Potential of Algal Biotechnology to Produce Antiviral Compounds and Biopharmaceuticals

“…Polyphenolic compounds have demonstrated antiviral activity against HIV [ 58 ], Herpes Virus (HV) [ 59 , 60 ], and Measles Virus (MV) [ 61 ]. Among them, phlorotannins biosynthesized via the acetate malonate pathway [ 62 ] comprise a whole spectrum of molecules produced by brown seaweed [ 63 ] with anti-allergic [ 64 ], antioxidant [ 65 ], and photoprotective [ 66 ] properties; with noticeable bioactivity in virus-related studies that include the Influenza virus [ 67 , 68 ], HIV [ 69 ], and Hepatitis Virus [ 70 ].…”

“…The ulvan SU1F1 from E. compressa inhibited viral penetration and had virucidal effects on HSV-1 [ 147 ]. SPs from U. intestinalis had low antiviral activity on the measles virus compared to SPs isolated from the seaweeds Eisenia arborea and Solieria filiformis [ 61 ]. The SPs from U. pertusa significantly induced avian influenza virus specific antibodies in vivo [ 148 ].…”

Virucidal Activity of Gold Nanoparticles Synthesized by Green Chemistry Using Garlic Extract

“…Quantitative Real-Time PCR was performed, total RNA was isolated from treated Vero cells using TRIzol™ Reagent Invitrogen™ (Thermo Fisher Scientific, Bedford, MA, USA). Reverse transcription was carried out using the High Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Beverly, MA, USA) and the viral genome was amplified with the specific primers: MeVF: 5 GAGGGTCAAACAGAGTCGAG 3 , MeVR: 5 CGGTTGGAAGATGGGCAG 3 that amplified a 95 nt fragment [11]. The real-time PCR was carried out using PowerUp™ SYBR™ Green Master Mix (Applied Biosystems, Beverly, MA, USA) and the Applied Biosystems StepOne Real Time PCR System following procedures: 95 • C for 2 min, followed by 40 cycles of 95 • C for 2 s, 60 • C for 10 s, and 72 • C for 20 s. The number of viral copies was calculated by using a standard curve.…”