Synthesis of Bis‐indole Carboxamides as G‐Quadruplex Stabilizing and Inducing Ligands

Abstract

The design and synthesis of a series of bis-indole carboxamides with varying amine containing side chains as G-quadruplex DNA stabilising small molecules are reported. Their interactions with quadruplexes have been evaluated by means of Förster resonance energy transfer (FRET) melting analysis, UV/Vis spectroscopy, circular dichroism spectroscopy and molecular modelling studies. FRET analysis indicates that these ligands exhibit significant selectivity for quadruplex over duplex DNA, and the position of the carboxamide side chains is of paramount importance in G-quadruplex stabilisation. UV/Vis titration studies reveal that bis-indole ligands bind tightly to quadruplexes and show a three- to fivefold preference for c-kit2 over h-telo quadruplex DNA. CD studies revealed that bis-indole carboxamide with a central pyridine ring induces the formation of a single, antiparallel, conformation of the h-telo quadruplex in the presence and absence of added salt. The chirality of h-telo quadruplex was transferred to the achiral ligand (induced CD) and the formation of a preferred atropisomer was observed.

A Water‐Soluble Tetraazaperopyrene Dye as Strong G‐Quadruplex DNA Binder

“…As displayed in Figure , the docking studies suggest that the end‐stacking binding mode, in which the planar π system of compound 1 stacks onto the external G‐quartets, is the most favourable binding mode for compound 1 interacting with c‐myc. This is in agreement with observations for other aromatic G‐quadruplex ligands . The interaction of compound 1 with the parallel c‐myc structure from 2L7V is predicted to be favourable by −10.9 kcal mol −1 .…”

“…Indeed, G‐quadruplex formation has been shown to hinder telomerase activity, but in addition it is implicated in the regulation of gene expression and quadruplex structures have thus become a potential target in oncology . A range of small molecules has been shown to strongly bind and stabilise such G‐quadruplex structures, thereby rendering these compounds potential anticancer drugs . Recent findings, such as the fact that parallel quadruplexes can still act as a substrate for telomerase, suggest, however, that indirect telomerase inhibition is not necessarily the dominant contribution in anticancer activity of quadruplex‐binding ligands.…”

Preparation of symmetrical C2-C2-linked bis- and tris-6-bromoindoles by Sonogashira couplings and 5-endo-dig cyclization induced by nBu4NF

“…Electron delocalization in 4a from the carbazole unit towards the alkyne carbon which should undergo nucleophilic attack from the carbamate anion renders the alkyne unreactive; on the contrary, in 4d no such electron delocalization is possible and the alkyne underwent cyclization (Scheme 4). Recent literature reports describe similar diarylalkyne substrates which have required gold catalysts using microwave 4 or ultrasound 37 techniques or indium tribromide 27 to accomplish the 5-endo-dig cyclization.…”

“…It is noteworthy that structural modifications of these natural products had led to synthetic analogs with DNAquadruplex recognition, 4 antibacterial, 5,6 antilesihmanial, 7 antitumoral, [8][9][10][11] and angiogenesis inhibition 12 activity. Most of these compounds are linked through the indole C3 position, with only a few exceptions such as Gelliusines F which is a C2-C3 linked bis-indole.…”

Environment‐Sensitive Probes Containing a 2,6‐Diethynylpyridine Motif for Fluorescence Turn‐On Detection and Induction of Nanoarchitectures of Human Telomeric Quadruplex

“…Absorption spectra were recorded on a Cary 100 UV/Vis double‐beam spectrophotometer with a 1 cm path length quartz cell. UV/Vis absorption titrations were carried out by the stepwise addition of the preannealed h‐TELO quadruplex (AGGGTTAGGGTTAGGGTTAGGGTT) and duplex DNA (5′‐AATCCGTCGAGCAGAGTT‐3′) in 100 m M KCl, 10 m M Tris ⋅ HCl, pH 7.4, buffer at 25 °C to a cell containing 25 μ M of ligands, and absorption spectra were recorded in the λ =200–500 nm range at 25 °C 24. The titration was stopped when the wavelength and intensity of the absorption bands for the ligands were unchanged upon three successive additions of the h‐TELO quadruplex.…”