Synthesis of Guanosine and Deoxyguanosine Phosphoramidites with Cross-Linkable Thioalkyl Tethers for Direct Incorporation into RNA and DNA

Hou, Xiaorong; Wang, Gang; Gaffney, Barbara L.; Jones, R. A. C.

doi:10.1080/15257770903368385

Cited by 13 publications

(9 citation statements)

References 42 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…We prepared the protected 2′-deoxyguanosine analogue 12 by reaction of dG with t-butyldimethylsilyl chloride, 42 followed by a Mitsunobu reaction with 2-(trimethylsilyl)ethanol to install the (2-trimethylsilyl)- ethyl group at O 6 of the guanine residue (Scheme 4). 51 The 2-deoxyribosyl donor, 3,5-bis( t -butyldimethylsilyl)-2-deoxyribosyl- 1-iodide was generated in situ via reaction of 1,3,5-tris(t- butyldimethylsilyl)-2-deoxyribose 13 with trimethylsilyl iodide (TMS-I) in CH 2 Cl 2 at −78 °C, and to this mixture was added a solution of 12 and diisopropylethylamine (DIEA) in CH 2 Cl 2 (Scheme 5). Our use of a 2- deoxyribosy l iodide rather than the previously reported ribosyl iodide necessitated some modifications of the literature method, 50 including lower reaction temperatures, a larger excess of the iodide, and greater equivalents of DIEA.…”

Section: Resultsmentioning

confidence: 99%

Chemical Structure and Properties of Interstrand Cross-Links Formed by Reaction of Guanine Residues with Abasic Sites in Duplex DNA

Catalano¹,

Liu

Andersen

et al. 2015

J. Am. Chem. Soc.

View full text Add to dashboard Cite

A new type of interstrand cross-link resulting from the reaction of a DNA abasic site with a guanine residue on the opposing strand of the double helix was recently identified, but the chemical connectivity of the cross-link was not rigorously established. The work described here was designed to characterize the chemical structure and properties of dG–AP cross-links generated in duplex DNA. The approach involved characterization of the nucleoside cross-link “remnant” released by enzymatic digestion of DNA duplexes containing the dG–AP cross-link. We first carried out a chemical synthesis and complete spectroscopic structure determination of the putative cross-link remnant 9b composed of a 2-deoxyribose adduct attached to the exocyclic N2-amino group of dG. A reduced analogue of the cross-link remnant was also prepared (11b). Liquid chromatography–tandem mass spectrometric (LC-MS/MS) analysis revealed that the retention times and mass spectral properties of synthetic standards 9b and 11b matched those of the authentic cross-link remnants released by enzymatic digestion of duplexes containing the native and reduced dG–AP cross-link, respectively. These results establish the chemical connectivity of the dG–AP cross-link released from duplex DNA and provide a foundation for detection of this lesion in biological samples. The dG–AP cross-link in duplex DNA was remarkably stable, decomposing with a half-life of 22 days at pH 7 and 23 °C. The intrinsic chemical stability of the dG–AP cross-link suggests that this lesion in duplex DNA may have the power to block DNA-processing enzymes involved in transcription and replication.

show abstract

Section: Resultsmentioning

confidence: 99%

Chemical Structure and Properties of Interstrand Cross-Links Formed by Reaction of Guanine Residues with Abasic Sites in Duplex DNA

Catalano¹,

Liu

Andersen

et al. 2015

J. Am. Chem. Soc.

View full text Add to dashboard Cite

show abstract

“…The 27-mer DNA template (5’ ATGGAAGGCGCCCGAACAGGGACTGTG 3’) was synthesized by Integrated DNA Technologies (Coralville, IA). The 20-mer primer (5’ ACAGTCCCTGTTCGG G CGCC 3’) bearing a cross-linkable thioalkyl tether (on G in the primer strand) 50 was custom synthesized by Midland Certified Reagent Company (Midland, TX) using phosphoramidite that was custom synthesized by Chemgenes (Wilmington, MA), and the primer was annealed to the template. The 27:20-mer dsDNA was cross-linked to RT127A at the mutated Q258C site of p66, and the cross-linked primer was extended with an AZT at the 3’-end through RT polymerization 51 .…”

Section: Methods (Online)mentioning

confidence: 99%

HIV-1 reverse transcriptase complex with DNA and nevirapine reveals non-nucleoside inhibition mechanism

Das

Martinez

Bauman

et al. 2012

Nat Struct Mol Biol

181

196

View full text Add to dashboard Cite

Combinations of nucleoside and nonnucleoside inhibitors (NNRTIs) of HIV-1 reverse transcriptase (RT) are widely used in anti-AIDS therapies. Five NNRTIs including nevirapine are clinical drugs; however, the molecular mechanism of inhibition by NNRTIs is not clear. We determined the crystal structures of RT–DNA–nevirapine, RT–DNA, and RT–DNA–AZT-triphosphate complexes at 2.85, 2.70, and 2.80 Å, respectively. The RT–DNA complex in the crystal could bind nevirapine or AZT-triphosphate; however, not both. Binding of nevirapine led to opening of the NNRTI-binding pocket. The pocket formation caused shifting of the 3’-end of DNA primer by ~5.5 Å away from its polymerase active site position. Nucleic acid interactions with fingers and palm subdomains were reduced, the dNTP-binding pocket was distorted, and the thumb opened up. The structures elucidate complementary roles of nucleoside and nonnucleoside inhibitors in inhibiting RT.

show abstract

“…A three‐carbon analog of cystamine could be used, but this compound (3,3′‐dithiobispropylamine; homocystamine) is not commercially available. It was custom synthesized at one point in the synthesis of the N 2 dG phosphoramidite . Linkers of any number of carbons could, in principle, be generated if the H 2 N(CH 2 ) n SS(CH 2 ) n NH 2 amine compound used as the source is available, where n = 2 for the cystamine used in this study.…”

Section: Resultsmentioning

confidence: 99%

“…It was custom synthesized at one point in the synthesis of the N 2 dG phosphoramidite. 13 Linkers of any number of carbons could, in principle, be generated if the H 2 N (CH 2 ) n SS(CH 2 ) n NH 2 amine compound used as the source is available, where n = 2 for the cystamine used in this study. However, as described in the Materials and Methods section, the two-carbon linker successfully cross-links to yield the desired RT/DNA complex.…”

Section: Preparation Of Hiv-1 Rt Cross-linked At I63c To N 6 Da In Tementioning

confidence: 99%

Structure of HIV‐1 reverse transcriptase/d4TTP complex: Novel DNA cross‐linking site and pH‐dependent conformational changes

et al. 2018

View full text Add to dashboard Cite

Stavudine (d4T, 2′,3′‐didehydro‐2′,3′‐dideoxythymidine) was one of the first chain‐terminating nucleoside analogs used to treat HIV infection. We present the first structure of the active, triphosphate form of d4T (d4TTP) bound to a catalytic complex of HIV‐1 RT/dsDNA template‐primer. We also present a new strategy for disulfide (S–S) chemical cross‐linking between N6 of a modified adenine at the second overhang base to I63C in the fingers subdomain of RT. The cross‐link site is upstream of the duplex‐binding region of RT, however, the structure is very similar to published RT structures with cross‐linking to Q258C in the thumb, which suggests that cross‐linking at either site does not appreciably perturb the RT/DNA structures. RT has a catalytic maximum at pH 7.5. We determined the X‐ray structures of the I63C‐RT/dsDNA/d4TTP cross‐linked complexes at pH 7, 7.5, 8, 8.5, 9, and 9.5. We found small (~0.5 Å), pH‐dependent motions of the fingers subdomain that folds in to form the dNTP‐binding pocket. We propose that the pH‐activity profile of RT relates to this motion of the fingers. Due to side effects of neuropathy and lipodystrophy, use of d4T has been stopped in most countries, however, chemical modification of d4T might lead to the development of a new class of nucleoside analogs targeting RNA and DNA polymerases.

show abstract

Synthesis of Guanosine and Deoxyguanosine Phosphoramidites with Cross-Linkable Thioalkyl Tethers for Direct Incorporation into RNA and DNA

Cited by 13 publications

References 42 publications

Chemical Structure and Properties of Interstrand Cross-Links Formed by Reaction of Guanine Residues with Abasic Sites in Duplex DNA

Chemical Structure and Properties of Interstrand Cross-Links Formed by Reaction of Guanine Residues with Abasic Sites in Duplex DNA

HIV-1 reverse transcriptase complex with DNA and nevirapine reveals non-nucleoside inhibition mechanism

Structure of HIV‐1 reverse transcriptase/d4TTP complex: Novel DNA cross‐linking site and pH‐dependent conformational changes

Contact Info

Product

Resources

About