Synthesis, purification, and characterization of human ciliary neuronotrophic factor from <i>E. coli</i>

Negro, Alessandro; Corona, Giuseppe; Bigon, E.; Martini, Irene; Grandi, Claudio; Skaper, Stephen D.; Callegaro, L.

doi:10.1002/jnr.490290216

Cited by 36 publications

(22 citation statements)

References 28 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The difference in biological activity seen between native and recombinant GPA is probably a reflection of the different purification protocols used and the fact that detergents increase the specific activity and stability of rGPA preparations. Recombinant GPA also had a higher specific activity than that reported for recombinant forms of CNTF (Negro et al, 1991;Gurney and Yamamoto, 1991;McDonald et al, 1991, Masiakowski et al, 19911, perhaps reflecting the greater efficacy of a conspecific molecule.…”

Section: Discussionmentioning

confidence: 80%

Expression of a chicken ciliary neurotrophic factor in targets of ciliary ganglion neurons during and after the cell-death phase

Finn

Nishi

1996

J. Comp. Neurol.

View full text Add to dashboard Cite

Ciliary ganglion (CG) neurons, like other neuronal populations, become dependent on their targets for survival during development. We have previously purified and cloned a secreted ciliary neurotrophic factor that was called growth-promoting activity (GPA). We report here the expression and purification of a highly active form of recombinant GPA, the preparation of GPA-specific polyclonal and monoclonal antibodies, and the use of these antibodies to investigate the cellular location and timing of GPA expression in tissues innervated by CG neurons. Virtually all of the trophic activity in extracts of embryonic eyes could be depleted by GPA-specific antibodies. GPA-like immunoreactivity was found in both targets of the CG: the arterial vasculature of the choroid layer and the ciliary body of the eye. In the choroid layer, GPA was localized to smooth muscle cells surrounding the choroid arteries. Staining in the choroid layer was first detectable at embryonic day (E) 10, or about 2 days after cell death has begun in the ganglion, then increased in intensity through E19. Quantification of trophic activity from whole eye extracts at various ages showed a small increase in activity observed between E9 and E12 and at least a 10-fold increase between E12 and E18. The presence of GPA protein in target cells of CG neurons during the specific developmental period when these neurons undergo cell death is consistent with its proposed function as a target-derived ciliary neurotrophic factor.

show abstract

Section: Discussionmentioning

confidence: 80%

Expression of a chicken ciliary neurotrophic factor in targets of ciliary ganglion neurons during and after the cell-death phase

Finn

Nishi

1996

J. Comp. Neurol.

View full text Add to dashboard Cite

show abstract

“…The pTAT‐CNTF plasmid was constructed to express the basic domain (amino acids 47–57) of HIV‐1 TAT fused with human CNTF. The coding sequence for human CNTF was amplified by PCR using the pT7.7 CNTF vector (Negro et al. 1991) as template and the following primers: 5′‐GCTCTAGAATGGCTTTCACAGAGCATTCACCG‐3′ and 5′‐GCGAATTCACATTTTCTTGTTGTTAGCAATA‐3′.…”

Section: Methodsmentioning

confidence: 99%

Ciliary neurotrophic factor fused to a protein transduction domain retains full neuroprotective activity in the absence of cytokine‐like side effects

Rezende

Peroni

Vieira

et al. 2009

Journal of Neurochemistry

View full text Add to dashboard Cite

Ciliary neurotrophic factor (CNTF) is a multifunctional cytokine that can regulate the survival and differentiation of many types of developing and adult neurons. CNTF prevents the degeneration of motor neurons after axotomy and in mouse mutant progressive motor neuronopathy, which has encouraged trials of CNTF for human motor neuron disease. Given systemically, however, CNTF causes severe side effects, including cachexia and a marked immune response, which has limited its clinical application. The present work describes a novel approach for administering recombinant human CNTF (rhCNTF) while conserving neurotrophic activity and avoiding deleterious side effects. rhCNTF was fused to a protein transduction domain derived from the human immunodeficiency virus‐1 TAT (transactivator) protein. The resulting fusion protein (TAT‐CNTF) crosses the plasma membrane within minutes and displays a nuclear localization. TAT‐CNTF was equipotent to rhCNTF in supporting the survival of cultured chicken embryo dorsal root ganglion neurons. Local or subcutaneous administration of TAT‐CNTF, like rhCNTF rescued motor neurons from death in neonatal rats subjected to sciatic nerve transection. In contrast to subcutaneous rhCNTF, which caused a 20–30% decrease in body weight in neonatal rats between postnatal days 2 and 7 together with a considerable fat mobilization in brown adipose tissue, TAT‐CNTF lacked such side effects. Together, these results indicate that rhCNTF fused with the protein transduction domain/TAT retains neurotrophic activity in the absence of CNTFs cytokine‐like side effects and may be a promising candidate for the treatment of motor neuron and other neurodegenerative diseases.

show abstract

“…In addition, the genes for rat, rabbit, and human CNTF have been cloned and biologically active forms of CNTF have been expressed in bacterial cells (Masiakowski et al, 1991, Negro et al, 1991. Even so, extensive purification and sophisticated methodologies are required to achieve purification, and many of the bacterial expression vectors are not commercially available.…”

Section: Introductionmentioning

confidence: 99%

Preparation and affinity purification of a novel, biologically active, CNTF fusion protein

Rabinovsky

Browder

McManaman

1994

J of Neuroscience Research

View full text Add to dashboard Cite

A biologically active fusion protein comprising a short hydrophilic leader peptide fused to the N-terminus of rat CNTF was generated using commercially available materials. The coding region for rat CNTF was sub-cloned into the pFLAG-1 vector and transfected into the JM 109 strain of E. coli. The transfected cells expressed high levels of the fusion protein (FLAG-CNTF) following induction by isopropyl beta-D-thiogalactoside (IPTG). FLAG-CNTF is expressed as insoluble material that was resolubilized by extraction with guanidine hydrochloride and purified by immuno-affinity chromatography. Analysis of the purified material by reverse phase HPLC and Western blot analysis indicated that FLAG-CNTF was composed of two closely related species that are greater than 99% pure after affinity chromatography. The purified FLAG-CNTF migrated as a 27 KD doublet on SDS polyacrylamide gel electrophoresis. Both bands of the doublet were shown to contain the FLAG peptide and CNTF by Western blot analysis, and amino acid sequence analysis demonstrated a single amino acid sequence corresponding to FLAG peptide and the N-terminus of CNTF. The purified fusion protein was tested for biological activity using the IMR-32 human neuroblastoma cell line. Treatment of IMR-32 cells with FLAG-CNTF increased the level of choline acetyltransferase (ChAT) in these cells 2-3-fold over that of control cells in a dose dependent manner. A direct comparison of the effects of FLAG-CNTF and recombinant human CNTF on IMR-32 ChAT activity showed that both factors exhibited similar potencies.(ABSTRACT TRUNCATED AT 250 WORDS)

show abstract

Synthesis, purification, and characterization of human ciliary neuronotrophic factor from E. coli

Cited by 36 publications

References 28 publications

Expression of a chicken ciliary neurotrophic factor in targets of ciliary ganglion neurons during and after the cell-death phase

Expression of a chicken ciliary neurotrophic factor in targets of ciliary ganglion neurons during and after the cell-death phase

Ciliary neurotrophic factor fused to a protein transduction domain retains full neuroprotective activity in the absence of cytokine‐like side effects

Preparation and affinity purification of a novel, biologically active, CNTF fusion protein

Contact Info

Product

Resources

About