Targeted Disruption of the CXCL12/CXCR4 Axis Inhibits Osteolysis in a Murine Model of Myeloma-Associated Bone Loss

Abstract

The plasma cell (PC) malignancy, multiple myeloma (MM), is unique among hematological malignancies in its capacity to cause osteoclast (OC)-mediated skeletal destruction. We have previously shown that elevated plasma levels of PC-derived CXCL12 are associated with presence of X-ray detectable osteolytic lesions in MM patients. To further investigate this relationship, plasma levels of CXCL12 and bCrossLaps, a marker of bone loss, were measured. A strong correlation between levels of CXCL12 and OCmediated bone resorption was identified. To confirm the OC-activating potential of MM PC-derived CXCL12 in vivo, we established a model of MM-mediated focal osteolysis, wherein MM PC lines, such as RPMI-8226, were injected into the tibias of nude mice. Implanting RPMI-8226 gave rise to osteolytic lesions proximal to the tumor, resulting in a 5% decrease in bone volume (BV) compared with vehicle control. Importantly, bone loss was significantly inhibited with systemic administration of the CXCL12/CXCR4 antagonist T140. Furthermore, implanting CXCL12-overexpressing RPMI-8226 cells resulted in a 13% decrease in BV and was associated with increased OC recruitment proximal to the tumor, increased serum matrix metalloproteinase activity, and increased levels of collagen I degradation products. These findings confirm our hypothesis that MM PC-derived CXCL12 stimulates the recruitment and activity of OC, thereby contributing to the formation of MM osteolytic lesions.

Myeloma plasma cells alter the bone marrow microenvironment by stimulating the proliferation of mesenchymal stromal cells

“…The use of luciferase labeled cells allowed us to monitor the progression of the disease using bioluminescent imaging techniques. 34 Tumor progression was monitored at 14 and 28 days post-tumor cell inoculation by live animal bioluminescent imaging ( Figure 5A). On Day 28-post tumor inoculation, mice were humanely killed and their long Multiple myeloma alters the bone microenvironment haematologica | 2014; 99 (1) 165 Figure 1.…”

Hypoxia-inducible factor-2 is a novel regulator of aberrant CXCL12 expression in multiple myeloma plasma cells

“…To generate stable over-expressing cell lines, full-length cDNA encoding human CXCL12, 27 HIF-1a, 28 and HIF-2a 29 were cloned into pRUF-IRES-GFP to generate pRUF-IRES-GFP-HIF-1a, pRUF-IRES-GFP-HIF-2a and pRUF-IRES-GFP-CXCL12. Following retroviral infection of LP-1 cells, pooled cell lines were established from the top 30% of GFP-expressing cells as previously described.…”

“…Following retroviral infection of LP-1 cells, pooled cell lines were established from the top 30% of GFP-expressing cells as previously described. 27 To generate stable knock-downs, RNA duplexes targeting human HIF-1a (CCATGAGGAAATGAGAGAAAT-GCTT), human HIF 2a (GGGGGCTGTGTCTGAGAAGAGT) or a scrambled control (CCAAGGAGTAAGAGATAAAG-GTC) 30,31 were cloned into the pFIV-H1-copGFP lentiviral vector (System Biosciences, CA, USA), and clonal cell lines generated from the top 10% of GFP-expressing cells using preparative cell sorting and single-cell deposition. For in vivo studies, cells were co-transduced with the SFG-NES-TGL luciferase vector 32 to enable bioluminescent detection of these cells.…”

NVP-BEZ235, a dual pan class I PI3 kinase and mTOR inhibitor, promotes osteogenic differentiation in human mesenchymal stromal cells

“…(40) Viral supernatant collected from transfected HEK-293T cells was used to infect SAOS-2 cells, and clonal cell lines were generated from the top 10% of green fluorescent protein (GFP)-expressing cells as described previously. (41) Calvarial organ cultures…”