Targeted inactivation of the X-linked adrenoleukodystrophy gene in mice

Abstract

In its severe form, X-linked adrenoleukodystrophy (ALD) is a lethal neurologic disease of children, characterized by progressive cerebral demyelination and adrenal insufficiency. Associated with a biochemical defect of peroxisomal beta-oxidation, very long-chain fatty acids (VLCFA) build up in tissues that have a high turnover of lipids, such as central nervous system (CNS) white matter, adrenal cortex, and testis. Whether the abnormal accumulation of VLCFA is the underlying cause of demyelination or merely an associated biochemical marker is unknown. ALD is caused by mutations in the gene for a peroxisomal membrane protein (ALDP) that shares structural features with ATP-binding-cassette (ABC) transporters. To analyze the cellular function of ALDP and to obtain an animal model of this debilitating disease, we have generated transgenic mice with a targeted inactivation of the ald gene. Motor functions in ALDP-deficient mice developed at schedule, and unexpectedly, adult animals appeared unaffected by neurologic symptoms up to at least 6 months of age. Biochemical analyses demonstrated impaired beta-oxidation in mutant fibroblasts and abnormal accumulation of VLCFAs in the CNS and kidney. In 6-month-old mutants, adrenal cortex cells displayed a ballooned morphology and needle-like lipid inclusions, also found in testis and ovaries. However, lipid inclusions and demyelinating lesions in the CNS were not a feature. Thus, complete absence of ALDP expression results in a VLCFA storage disease but does not impair CNS function of young adult mice by pathologic and clinical criteria. This suggests that additional genetic or environmental conditions must be fulfilled to model the early-onset and lethality of cerebral ALD in transgenic mice.

Readthrough of nonsense mutations in Rett syndrome: evaluation of novel aminoglycosides and generation of a new mouse model

“…R1 mouse embryonic stem cells were electroporated with 50 μg of the linearized targeting vector, and colonies were isolated after G418 selection as previously described [15]. Five G418-resistant clones were identified as homologous recombinants by nested PCR amplification of a 1.9-kb genomic fragment.…”

“…For the first PCR step, we used 25 cycles, and 40 cycles were used for the second step. Microinjection of selected ES cells into C57BL/6 blastocysts and embryo transfer to pseudopregnant females was performed by standard procedures [15]. Highly chimeric males were bred to C57BL/6 female, and germ line transmission was confirmed by PCR and sequencing.…”

Peroxisomal dysfunctions cause lysosomal storage and axonal Kv1 channel redistribution in peripheral neuropathy

“…To investigate whether this new pathomechanism, identified in two mouse models with a glia-specific mutation, is also relevant for a human genetic disease, we analyzed ABCD1-deficient mice, a model for X-ALD/AMN (Forss-Petter et al, 1997). Sciatic nerve axons and myelin were morphologically intact, even at 22 months of age (Figure 4a–c).…”

“…PCR was performed with sense (5’- CCAACGTCTGCCCATTCCTCCACCTG-3’) and antisense primers (5’- TTTGAGGATGGGAAGCAGTGCT −3’) generating a 330 bp amplicon after Cre-mediated excision of the floxed Pex5 gene in conditional knockout mice. Hsd17b4 flox/flox ( Mfp2 flox/flox ) mice and Abcd1 knockout mice with C57/Bl6 genetic background were genotyped by PCR as described (Verheijden et al, 2013; Forss-Petter et al, 1997). Animals were maintained in individually ventilated cages under SPF conditions.…”

X-linked Adrenoleukodystrophy

“…In 1997, Abcd1 null mice were obtained in 3 laboratories [26][27][28]. However, Abcd1 null mice only develop a late onset spinal cord pathology resembling the AMN phenotype [29] and an animal model for the most severe form of the disease, i.e.…”