Telomere dynamics in patients with del (5q) MDS before and under treatment with lenalidomide

Beier, Fabian; Masouleh, Behzad Kharabi; Buesche, Guntram; Ferreira, Mónica S. Ventura; Schneider, Rebekka K.; Ziegler, Patrick; Wilop, Stefan; Vankann, Lucia; Gattermann, Norbert; Platzbecker, Uwe; Giagounidis, Aristoteles; Götze, Katharina; Nolte, Florian; Hofmann, Wolf‐Karsten; Haase, Detlef; Kreipe, Hans; Panse, Jens; Blasco, María A.; Germing, Ulrich; Brümmendorf, Tim H.

doi:10.1016/j.leukres.2015.09.003

Cited by 16 publications

(23 citation statements)

References 27 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Sorted CD57 − CD45RA + “naïve” CD8 + T cells and CD57 + “senescent” CD8 + T cells were fixed in a 3:1 solution of ice‐cold methanol:acetic acid. Cell suspensions were dropped onto microscope slides and dried at room temperature (RT) for 2 h. Q‐FISH staining was carried out as described previously . Briefly, cells were stained for telomeres with a Cy3‐conjugated (C3TA2) 3 PNA telomeric probe (Panagene, Daejeon, Korea).…”

Section: Methodsmentioning

confidence: 99%

CD57 identifies T cells with functional senescence before terminal differentiation and relative telomere shortening in patients with activated PI3 kinase delta syndrome

et al. 2018

Self Cite

View full text Add to dashboard Cite

Premature T-cell immunosenescence with CD57 CD8 T-cell accumulation has been linked to immunodeficiency and autoimmunity in primary immunodeficiencies including activated PI3 kinase delta syndrome (APDS). To address whether CD57 marks the typical senescent T-cell population seen in adult individuals or identifies a distinct population in APDS, we compared CD57 CD8 T cells from mostly pediatric APDS patients to those of healthy adults with similarly prominent senescent T cells. CD57 CD8 T cells from APDS patients were less differentiated with more CD27 CD28 effector memory T cells showing increased PD1 and Eomesodermin expression. In addition, transition of naïve to CD57 CD8 T cells was not associated with the characteristic telomere shortening. Nevertheless, they showed the increased interferon-gamma secretion, enhanced degranulation and reduced in vitro proliferation typical of senescent CD57 CD8 T cells. Thus, hyperactive PI3 kinase signaling favors premature accumulation of a CD57 CD8 T-cell population, which shows most functional features of typical senescent T cells, but is different in terms of differentiation and relative telomere shortening. Initial observations indicate that this specific differentiation state may offer the opportunity to revert premature T-cell immunosenescence and its potential contribution to inflammation and immunodeficiency in APDS.

show abstract

Section: Methodsmentioning

confidence: 99%

CD57 identifies T cells with functional senescence before terminal differentiation and relative telomere shortening in patients with activated PI3 kinase delta syndrome

et al. 2018

Self Cite

View full text Add to dashboard Cite

show abstract

“…20,21 Flow-FISH Vital sterile frozen MNC from PB was used for the flow-FISH analysis of TL, as previously described. [22][23][24][25][26] Briefly, samples were prepared for cell denaturation and mixed with an FITC-labeled telomere-specific (CCCTAA)3-peptide nucleic acid FISH probe (Eurogentec, Liège, Belgium) for DNA hybridization followed by DNA counterstaining with LDS 751 (Sigma). Bovine thymocytes were used as internal controls.…”

Section: Patientsmentioning

confidence: 99%

“…Healthy controls (n = 365) were used for age adaptation of TL for flow-FISH, as described previously. [22][23][24][25][26] A separate cohort of 89 healthy controls was used for age adaption of TL for MM-qPCR. 27,28 MM-qPCR TL analysis by MM-qPCR followed the original protocol described by Cawthon et al 29,30 Essentially, primer pairs used for telomere amplification were telg 5 -ACACTAAGGTTTGGGTTTGGGTTTGG GTTTGGGTTAGTGT-3 and telc 5 -TGTTAGG TATCCCTATCCCTATCCCTATCCCTATCCCTA ACA-3 , while signal acquisition was at 74°C.…”

Section: Patientsmentioning

confidence: 99%

Comparison of flow‐FISH and MM–qPCR telomere length assessment techniques for the screening of telomeropathies

Ferreira

Kirschner

Halfmeyer

et al. 2019

Annals of the New York Academy of Sciences

Self Cite

View full text Add to dashboard Cite

Assessment of telomere length (TL) in peripheral blood leukocytes is part of the diagnostic algorithm applied to patients with acquired bone marrow failure syndromes (BMFSs) and dyskeratosis congenita (DKC). Monochrome multiplex-quantitative polymerase chain reaction (MM-qPCR) and fluorescence in situ hybridization (flow-FISH) are methodologies available for TL screening. Dependent on TL expressed in relation to percentiles of healthy controls, further genetic testing for inherited mutations in telomere maintenance genes is recommended. However, the correct threshold to trigger this genetic workup is still under debate. Here, we prospectively compared MM-qPCR and flow-FISH regarding their capacity for accurate identification of DKC patients. All patients (n = 105) underwent genetic testing by next-generation sequencing and in 16 patients, mutations in DKC-relevant genes were identified. Whole leukocyte TL of patients measured by MM-qPCR was found to be moderately correlated with lymphocyte TL measured by flow-FISH (r 2 = 0.34; P < 0.0001). The sensitivity of both methods was high, but the specificity of MM-qPCR (29%) was significantly lower compared with flow-FISH (58%). These results suggest that MM-qPCR of peripheral blood cells is inferior to flow-FISH for clinical routine screening for suspected DKC in adult patients with BMFS due to lower specificity and a higher rate of false-positive results.

show abstract

“…Cow thymocytes with a previously determined telomere length were used as both an internal control and a standard to translate telomere fluorescence into kilobases. Cow thymocytes and liver cells were identified based on their forward scatter properties and LDS 751 fluorescence [15, 16]. …”

Section: Methodsmentioning

confidence: 99%

Influence of Telomere Length in Hepatocytes on Liver Regeneration after Partial Hepatectomy in Rats

et al. 2018

Self Cite

View full text Add to dashboard Cite

Background: The aim of this study was to investigate telomere length in hepatocytes as a biomarker for liver regeneration after partial hepatectomy (PH) in rats. Materials and Methods: Sixty male Wistar rats underwent a 70% PH. One-month-old rats were assigned to group Y (n = 30) and 4-month-old rats were assigned to group O (n = 30). The rats were euthanized, and their livers were then harvested at postoperative day (POD) 1, 2, 3, 4, or 7. Telomere lengths and established parameters for liver regeneration (residual liver weight and levels of proliferating cell nuclear antigen [PCNA], Ki67, and interleukin [IL]-6) were measured. Results: We observed a significant increase in residual liver weight in group Y compared to that in group O (p = 0.001). The levels of Ki67 (p = 0.016), PCNA (p < 0.0001), and IL-6 (p < 0.001) were significantly higher in group Y. Furthermore, the rats in group Y had significantly earlier peak values of Ki67 and PCNA. Telomeres were significantly longer at the time of PH in group Y (p = 0.001). We showed a correlation between telomere length at the day of PH and liver regeneration. Animals with longer telomeres at the time of PH had better liver regeneration (p = 0.015). In group Y, animals with increased liver regeneration (median cut-off: > 122%) did not show any significant difference in telomere length (p = 0.587) compared to rats with regular regeneration (< 122%). However, in the older animals, rats with increased regeneration had significantly longer telomeres (p = 0.019) than rats with regular regeneration. Conclusion: Telomere length in rat hepatocytes depends on age, and animals with long telomeres had earlier and better regeneration of healthy liver tissue than rats with short telomeres. Our data confirms that telomere length in rat hepatocytes could be used as a possible predictive marker for liver regeneration, and could help to identify older individuals with a high capacity for hepatic regeneration.

show abstract

Telomere dynamics in patients with del (5q) MDS before and under treatment with lenalidomide

Cited by 16 publications

References 27 publications

CD57 identifies T cells with functional senescence before terminal differentiation and relative telomere shortening in patients with activated PI3 kinase delta syndrome

CD57 identifies T cells with functional senescence before terminal differentiation and relative telomere shortening in patients with activated PI3 kinase delta syndrome

Comparison of flow‐FISH and MM–qPCR telomere length assessment techniques for the screening of telomeropathies

Influence of Telomere Length in Hepatocytes on Liver Regeneration after Partial Hepatectomy in Rats

Contact Info

Product

Resources

About