Terminal restriction fragment length polymorphism analysis of ribosomal RNA genes to assess changes in fungal community structure in soils

Abstract

Monitoring the structure and dynamics of fungal communities in soils under agricultural and environmental disturbances is currently a challenge. In this study, a terminal restriction fragment length polymorphism (T-RFLP) fingerprinting method was developed for the rapid comparison of fungal community structures. The terminal restriction fragment polymorphism of different regions of the small-subunit (SSU) ribosomal RNA (rRNA) gene was simulated by sequence comparison using 10 restriction enzymes, and analyzed among three different soils using fungal-specific primers. Polymerase chain reaction amplification of the 3' end of the SSU rRNA gene with the primer nu-SSU-0817-5' and with the fluorescently labelled primer nu-SSU-1536-3', and digestion of the amplicons with AluI and MboI were found to be optimal and were used in a standardized T-RFLP procedure. Both the number and the intensity of terminal restriction fragments detected by capillary gel electrophoresis were integrated in correspondence analyses. Three soils with contrasting physicochemical properties were differentiated according to the structure of their fungal communities. Assessment of the impact on the fungal community structure of the amendment of two soils with compost or manure confirmed the reproducibility and the sensitivity of the method. Shifts in the community structure were detected between non-amended and amended soil samples. In both soils, the shift differed with the organic amendment applied. In addition, the fungal community structures of the two soils were affected in a different way by the same organic amendment. The fingerprinting method provides a rapid tool to investigate the effect of various perturbations on the fungal communities in soils.

Fungal Community Analysis by Large-Scale Sequencing of Environmental Samples

“…While sequencing rRNA clones is standard practice in environmental bacteriology, most fungal studies using environmental sampling have employed either fingerprinting methods based on banding patterns obtained from restriction site polymorphisms (13) or denaturing gradient gel electrophoresis profiles (2,37). These methods can be useful for detecting overall community shifts in response to environmental variables and for tracking the presence or absence of individual OTUs in different samples.…”

“…This technique has become an indispensable tool in bacterial soil ecology, but its use in studies of eukaryotic microorganisms has been limited. Sequence-based studies have been carried out on fungi from grass leaves (6), plant roots (10,35,38), and soil (30), but most studies have been restricted to the use of methods based on fragment length polymorphisms (13,39) or denaturing gradient gel electrophoresis (2,37). These methods collectively have the potential to improve our understanding of fungal biodiversity and facilitate ecological studies of soil communities.…”

Large-scale patterns in biodiversity of microbial eukaryotes from the abyssal sea floor

“…Genomic DNA was extracted from the filters using a general phenol/ chloroform/CTAB extraction protocol (47) and further purified by Sepharose 4B/PVPP columns (48). Genomic DNA from the same sampling region was pooled together.…”

Biotic changes in relation to local decrease in soil conduciveness to disease caused by Rhizoctonia solani

“…DNA was extracted from samples of 1 g of soil using the method described by Edel-Hermann et al (2004). Briefly, the DNA extraction was done with the help of chemical extractant (sodium dodecyl sulphate, SDS) as well as physical disruption (bead-beater).…”

“…The genetic structure of microbial communities in the different soil samples was investigated using terminal restriction fragment length polymorphism (T-RFLP) of 16S and 18S ribosomal RNA (rRNA) genes for bacteria and fungi, respectively (Edel-Hermann et al 2004;Pérez-Piqueres et al 2006). Bacterial 16S rDNA was amplified by PCR using the primer 27F (AGAGTTTGATCCTGGCTCAG) labelled with the fluorescent dye D3 (Beckman Coulter, Fullerton, CA, USA) and the primer 1392R (ACGGGCGGTGT GTACA) and digested with the restriction enzyme HaeIII (Q-BIOgene).…”