TGF-β Signaling Promotes Tissue Formation during Cardiac Valve Regeneration in Adult Zebrafish

Bensimon-Brito, Anabela; Ramkumar, Srinath; Boezio, Giulia L. M.; Guenther, Stefan; Kuenne, Carsten; Helker, Christian S. M.; Sánchez-Iranzo, Héctor; Iloska, Dijana; Piesker, Janett; Pullamsetti, Soni Savai; Mercader, Nadia; Beis, Dimitris; Stainier, Didier Y.R.

doi:10.1016/j.devcel.2019.10.027

Cited by 40 publications

(40 citation statements)

References 112 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…To generate the plasmid with a zebrafish desmb promoter driving Firefly Luciferase expression (pGl4.14-luc; SV40:hRLuc) ( Bensimon-Brito et al, 2020 ), we cloned 800 bp of the promoter region of desmb using the following primers: forward – 5′- GAAAGCATAGTCTGCTTTCTCG -3′ and reverse – 5′- GAGCGCCGGACAGCAGCC- 3′.…”

Section: Methodsmentioning

confidence: 99%

The EMT transcription factor Snai1 maintains myocardial wall integrity by repressing intermediate filament gene expression

Gentile

Bensimon-Brito

Priya

et al. 2021

eLife

Self Cite

View full text Add to dashboard Cite

The transcription factor Snai1, a well-known regulator of epithelial-to-mesenchymal transition, has been implicated in early cardiac morphogenesis as well as in cardiac valve formation. However, a role for Snai1 in regulating other aspects of cardiac morphogenesis has not been reported. Using genetic, transcriptomic, and chimeric analyses in zebrafish, we find that Snai1b is required in cardiomyocytes for myocardial wall integrity. Loss of snai1b increases the frequency of cardiomyocyte extrusion away from the cardiac lumen. Extruding cardiomyocytes exhibit increased actomyosin contractility basally as revealed by enrichment of p-myosin and α-catenin epitope α-18, as well as disrupted intercellular junctions. Transcriptomic analysis of wild-type and snai1b mutant hearts revealed the dysregulation of intermediate filament genes, including desmin b (desmb) upregulation. Cardiomyocyte-specific desmb overexpression caused increased cardiomyocyte extrusion, recapitulating the snai1b mutant phenotype. Altogether, these results indicate that Snai1 maintains the integrity of the myocardial epithelium, at least in part by repressing desmb expression.

show abstract

Section: Methodsmentioning

confidence: 99%

The EMT transcription factor Snai1 maintains myocardial wall integrity by repressing intermediate filament gene expression

Gentile

Bensimon-Brito

Priya

et al. 2021

eLife

Self Cite

View full text Add to dashboard Cite

show abstract

“…Moreover, direct comparison of the cell types as percentage of total cell count showed all the identified cell types were represented in comparable numbers between untreated and morphine-treated fish (Figure 3C). Plotting the mRNA expression of the individual genes with a defined role in regeneration including aldh1a2, cxcl12a, postnb, gata4, cxcr4b, fn1a, col1a1a , and tgf1b (Bensimon-Brito et al, 2020; Gupta et al, 2013; Itou et al, 2012; Kikuchi et al, 2011; Kim et al, 2010; Liu et al, 2018; Moyse and Richardson, 2020; Sánchez-Iranzo et al, 2018; Wang et al, 2013) did not reveal any significant differences between the untreated and morphine-treated fish (Figure 3D). Quantifying the relative mRNA expression of a subset of these genes further corroborated our scRNAseq data (Figure 3E).…”

Section: Resultsmentioning

confidence: 99%

“…Importantly, our detailed comparison of the cellular and molecular responses between control and morphine-treated fish determined major differences neither in the cellular composition nor at the transcriptional level. We have tested not only genes with established roles in the heart regeneration (Bensimon-Brito et al, 2020; Gupta et al, 2013; Itou et al, 2012; Kikuchi et al, 2011; Kim et al, 2010; Liu et al, 2018; Moyse and Richardson, 2020; Sánchez-Iranzo et al, 2018; Wang et al, 2013), but have also probed the proliferative response of CM, which is a hallmark of the zebrafish heart regeneration. We, however, advise caution as the earliest assessed transcriptomes were of hearts isolated at 3dpi, and thus we cannot rule out morphine effects on the early wound healing and on the immunological response.…”

Section: Discussionmentioning

confidence: 99%

Morphine alleviates pain after heart cryoinjury in zebrafish without impeding regeneration

Simões

Alameldeen

et al. 2020

Preprint

View full text Add to dashboard Cite

SummaryNociceptive response belongs to a basic animal behavior facilitating adaptability and survival upon external or internal stimuli. Fish, similarly to higher vertebrates, also possess nociceptive machinery. Current protocols involving procedures performed on adult zebrafish including heart cryoinjury do not, however, take into account the adverse effects including pain that may potentially arise from these methodologies. Here, we assess the effect of two analgesics, lidocaine and morphine, followed after heart cryoinjury in zebrafish. Monitoring swimming behavior together with histology and gene expression analysis at the single cell level using scRNA sequencing and RNAscope fluorescent in situ hybridization technology, we show morphine, but not lidocaine, significantly improves animal welfare 6 hours post-cryoinjury, without impairing the heart regeneration process. Altogether, we propose morphine to be considered as the analgesic of choice to reduce post-surgical pain in adult zebrafish.HighlightsCryoinury could be considered as a potential noxious stimulus in adult zebrafish.Morphine but not lidocaine treatment effectively alleviates noxious effects post-cryoinjury.Lidocaine treatment delays heart repair and regeneration.6 hours Morphine treatment after cryoinjury does not impede heart regeneration.

show abstract

“…The smaller size of the zebrafish heart, and thus the smaller valves, the absence of lungs and the lack of oxygen dependence early in development might account for these differences. There is also evidence that, unlike avian or mammalian valves, zebrafish valves are capable of regeneration; this process involves TGFβ signalingmediated proliferation of endothelial-and kidney marrow-derived valve cells (Bensimon-Brito et al, 2020).…”

Section: Elongation and Maturation Of Primordial Valvesmentioning

confidence: 99%

Mechanisms of heart valve development and disease

O’Donnell

Yutzey

2020

Development

View full text Add to dashboard Cite

The valves of the heart are crucial for ensuring that blood flows in one direction from the heart, through the lungs and back to the rest of the body. Heart valve development is regulated by complex interactions between different cardiac cell types and is subject to blood flow-driven forces. Recent work has begun to elucidate the important roles of developmental pathways, valve cell heterogeneity and hemodynamics in determining the structure and function of developing valves. Furthermore, this work has revealed that many key genetic pathways involved in cardiac valve development are also implicated in diseased valves. Here, we review recent discoveries that have furthered our understanding of the molecular, cellular and mechanosensitive mechanisms of valve development, and highlight new insights into congenital and acquired valve disease.

show abstract

TGF-β Signaling Promotes Tissue Formation during Cardiac Valve Regeneration in Adult Zebrafish

Cited by 40 publications

References 112 publications

The EMT transcription factor Snai1 maintains myocardial wall integrity by repressing intermediate filament gene expression

The EMT transcription factor Snai1 maintains myocardial wall integrity by repressing intermediate filament gene expression

Morphine alleviates pain after heart cryoinjury in zebrafish without impeding regeneration

Mechanisms of heart valve development and disease

Contact Info

Product

Resources

About