The alternatively spliced exon of the platelet-derived growth factor A chain encodes a nuclear targeting signal.

Abstract

We have previously shown that the SIS/platelet-derived growth factor B chain contains a nuclear targeting signal near its C terminus. Here we show that the platelet-derived growth factor A chain also contains a nuclear targeting signal encoded by an exon which is subject to alternative splicing. This sequence is capable of targeting a nonsecreted form of the A chain to the nucleus and can also target the cytoplasmic proteins dihydrofolate reductase, chloramphenicol acetyltransferase, and pyruvate kinase to the nucleus.Platelet-derived growth factor (PDGF) is a potent mitogen for cells of mesenchymal origin. Human PDGF is composed of two related polypeptide chains (A and B) linked by disulfide bonds (19). Each chain is also able to form homodimers, as exemplified by the B-chain homodimers produced in simian sarcoma virus-transformed cells (9) and by the A-chain homodimers produced in various tumor cell lines (2). The A-chain protein appears to have either of two different C termini which result from alternative splicing of the RNA (7, 21). The predicted PDGF A-chain protein encoded by a human glial tumor cDNA (2) (referred to here as the long form) contains a sequence near its C terminus (RPRESGKKRKRKR) that is similar to the nuclear targeting signal (NTS) we had previously identified in the SIS/ B-chain protein (RRPPKGKHRK). Subsequently, A-chain cDNAs isolated from endothelial cells (4,7,21) and from the glioma cell line from which the original A-chain clone was isolated (18) were shown to encode a shorter protein (referred to as the short form), with the C terminus coded for by a different exon. No differences in biological activity between the long and short forms of the PDGF A chain have yet been found (1).To determine whether the A chain contains a NTS, eucaryotic expression vectors containing the long A chain as well as nonsecreted forms of the long and short A chains were constructed. Plasmid D-1, containing the longer PDGF A-chain cDNA derived from a human glioma, was obtained (2). The A-chain-coding region from D-1 was then inserted into a vector derived from pRSV (8) downstream of a Rous sarcoma virus promoter, creating pDM109. The short form of the A chain lacking the NTS was created through loop-out mutagenesis in m13 by using an oligonucleotide corresponding to the exon 5-exon 7 junction which occurs in the short form of the A chain (GAGGACACGGATGTGAGGTG AGG). The native A-chain protein contains a signal sequence at its N terminus, allowing its secretion. Since signal sequences function cotranslationally, it was necessary to remove this in order to examine the C terminus for its ability to direct import to the nucleus. Nonsecreted forms of the different A chains were created by joining a consensus start codon for eucaryotic initiation (12,14) to the A-chain-coding sequences at a TaqI site so that the resulting proteins would resemble the mature A chains after propeptide cleavage. These nonsecreted forms were also placed in a Rous sar-* Corresponding author. coma virus vector, yielding pDM134 (nonsec...

Alternatively spliced platelet-derived growth factor A-chain transcripts are not tumor specific but encode normal cellular proteins.

“…Both antibodies exhibit intracellular staining in the myoblasts, whereas the nuclei are conspicuously unstained. These data do not support the hypothesis, proposed by Maher et al (13), that exon 6 encodes a nuclear targeting signal. St.…”

Nuclear accumulation of interferon gamma.

“…However, our data permit us to propose a direct role ofIFN--y in the cascade of events involved in signal transduction. Other cytokines, such as platelet-derived growth factor (26) and basic fibroblast growth factor (27), have been shown to contain functional NLSs.…”

Brain-derived neurotrophic factor: subcellular compartmentalization and interneuronal transfer as visualized with anti-peptide antibodies.

“…FGF and platelet-derived growth factor have been detected in the nuclei of nonneuronal cells (38)(39)(40)(41)(42), and it recently has been demonstrated that nuclear translocation is essential for maintaining mitogenic activity of acidic FGF (43). While nuclear translocation sequences are not always easily identifiable in protein sequences, they typically consist of 4-10 amino acid residues, rich in the basic amino acids arginine or lysine and often including a proline or a valine (44,45).…”