We have previously shown that the SIS/platelet-derived growth factor B chain contains a nuclear targeting signal near its C terminus. Here we show that the platelet-derived growth factor A chain also contains a nuclear targeting signal encoded by an exon which is subject to alternative splicing. This sequence is capable of targeting a nonsecreted form of the A chain to the nucleus and can also target the cytoplasmic proteins dihydrofolate reductase, chloramphenicol acetyltransferase, and pyruvate kinase to the nucleus.Platelet-derived growth factor (PDGF) is a potent mitogen for cells of mesenchymal origin. Human PDGF is composed of two related polypeptide chains (A and B) linked by disulfide bonds (19). Each chain is also able to form homodimers, as exemplified by the B-chain homodimers produced in simian sarcoma virus-transformed cells (9) and by the A-chain homodimers produced in various tumor cell lines (2). The A-chain protein appears to have either of two different C termini which result from alternative splicing of the RNA (7, 21). The predicted PDGF A-chain protein encoded by a human glial tumor cDNA (2) (referred to here as the long form) contains a sequence near its C terminus (RPRESGKKRKRKR) that is similar to the nuclear targeting signal (NTS) we had previously identified in the SIS/ B-chain protein (RRPPKGKHRK). Subsequently, A-chain cDNAs isolated from endothelial cells (4,7,21) and from the glioma cell line from which the original A-chain clone was isolated (18) were shown to encode a shorter protein (referred to as the short form), with the C terminus coded for by a different exon. No differences in biological activity between the long and short forms of the PDGF A chain have yet been found (1).To determine whether the A chain contains a NTS, eucaryotic expression vectors containing the long A chain as well as nonsecreted forms of the long and short A chains were constructed. Plasmid D-1, containing the longer PDGF A-chain cDNA derived from a human glioma, was obtained (2). The A-chain-coding region from D-1 was then inserted into a vector derived from pRSV (8) downstream of a Rous sarcoma virus promoter, creating pDM109. The short form of the A chain lacking the NTS was created through loop-out mutagenesis in m13 by using an oligonucleotide corresponding to the exon 5-exon 7 junction which occurs in the short form of the A chain (GAGGACACGGATGTGAGGTG AGG). The native A-chain protein contains a signal sequence at its N terminus, allowing its secretion. Since signal sequences function cotranslationally, it was necessary to remove this in order to examine the C terminus for its ability to direct import to the nucleus. Nonsecreted forms of the different A chains were created by joining a consensus start codon for eucaryotic initiation (12,14) to the A-chain-coding sequences at a TaqI site so that the resulting proteins would resemble the mature A chains after propeptide cleavage. These nonsecreted forms were also placed in a Rous sar-* Corresponding author. coma virus vector, yielding pDM134 (nonsec...

Abstract. An important question regarding autocrine transformation by v-sis is whether intracellularly activated PDGF receptors are sufficient to transform cells or whether activated receptor-ligand complexes are required at the cell surface. We have addressed this question by inhibiting cell surface transport of a membraneanchored v-sis protein utilizing the ER retention signal of the adenoviral transmembrane protein E3/19K. A v-sis fusion protein containing this signal was retained within the cell and not transported to the cell surface as confirmed by immunofluorescent localization experiments. Also, proteolytic maturation of this protein was suppressed, indicating inefficient transport to postGolgi compartments of the secretory pathway. When compared with v-sis proteins lacking a functional retention signal, the ER-retained protein showed a diminished ability to transform NIH 3T3 cells, as measured by the number and size of foci formed. In newly established cell lines, the ER-retained protein did not downregulate PDGF receptors. However, continued passage of these cells selected for a fully transformed phenotype exhibiting downregulated PDGF receptors and proteolytically processed v-sis protein. These results indicate that productive autocrine interactions occur in a post-ER compartment of the secretory pathway. Transport of v-sis protein beyond the Golgi correlated with acquisition of the transformed phenotype. Furthermore, suramin treatment reversed transformation and upregulated the expression of cell surface PDGF receptors, suggesting an important role for receptor-ligand complexes localized to the cell surface.

We have previously shown that the SIS/platelet-derived growth factor B chain contains a nuclear targeting signal near its C terminus. Here we show that the platelet-derived growth factor A chain also contains a nuclear targeting signal encoded by an exon which is subject to alternative splicing. This sequence is capable of targeting a nonsecreted form of the A chain to the nucleus and can also target the cytoplasmic proteins dihydrofolate reductase, chloramphenicol acetyltransferase, and pyruvate kinase to the nucleus.

The v-vis gene encodes p28sis, the transforming protein of simian sarcoma virus. This gene resulted from a fusion of the env gene of simian sarcoma-associated virus and the woolly monkey gene for the B chain of platelet-derived growth factor (PDGF). Previous work has shown that the v-sis gene product undergoes signal sequence cleavage, glycosylation, dimerization, and proteolytic processing to yield a secreted form of the protein. It transport across the endoplasmic reticulum is blocked by the introduction of a charged amino acid residue within the signal sequence, the protein does not dimerize, is not secreted, and is no longer transforming as assayed by focus-forming ability in NIH 3T3 cells. Instead, this mutant protein localizes to the nucleus as demonstrated by both indirect immunofluorescence and cell fractionation. Using a series of deletion mutations, we delimited an amino acid sequence within this protein which is responsible for nuclear localization. This region is completely conserved in the predicted human c-sis protein, although it lies outside of regions required for transformation by the v-sis gene product. This nuclear transport signal is contained within amino acid residues 237 to 255, RVTIRTVRVRRPPKGKHRK. An amino acid sequence containing these residues is capable of directing cytoplasmic v-sis mutant proteins to the nucleus. This sequence is also capable of directing less efficient nuclear transport of a normally cytoplasmic protein, pyruvate kinase. Pulse-chase experiments indicate that the half-lives of nuclear and cytoplasmic v-sis mutant proteins are approximately 35 min. Using the heat-inducible hsp70 promoter from Drosophila melanogaster, we showed that the nuclear v-sis protein accumulates in the nucleus within 30 min of induction. The identification of a nuclear transport signal in the v-sis gene product raises interesting questions regarding the possibility of some function for PDGF or PDGF-related molecules in the nucleus.