The complete nucleotide sequence of RNa1 of barley mild mosaic virus (asl1) and attempts at bacterial expression of the P3 protein

Abstract

The complete nucleotide sequence of RNA1 of an Aschersleben isolate of barley mild mosaic virus (BaMMV) was determined. It consists of 7263 nucleotides (nt) excluding the 3′ poly (A) tail. The 5′ and 3′ nontranslated regions (NTR) are 148 and 338 nt in length, respectively, and flank a single large open reading frame coding for a precursor polypeptide with a calculated molecular mass of 256 kDa. Sequence comparison revealed a 96% amino acid (aa) identity to RNA1 translation products of Japanese and French BaMMV isolates. Conserved nucleotide motifs in the 3′ sense and 5′ complementary sense NTR of the two genomic RNAs were identified that may represent the polymerase recognition sites. A range of constructs containing various parts of the coding region of the P3 nonstructural protein was prepared for expression in Escherichia coli. A short stretch of 35 aa in the C‐proximal region of P3 appeared to be highly toxic to the bacterium.

Identification of Barley mild mosaic virus Isolates in Germany Breaking rym5 Resistance*

“…‘Tokyo’ under controlled conditions, the VPg coding region was analysed by sequencing six independent clones derived from two plants for each isolate. Figure 3 presents summarized results as an alignment of amino acid sequences of the VPg cistron including the standard BaMMV strain (Subr et al., 2000) and the sequence of the French pathotype (Kanyuka et al., 2004).…”

“…To amplify the VPg coding fragment of the BaMMV genome by IC‐RT‐PCR, sap from infected leaves was incubated overnight at 4°C in PCR tubes precoated with BaMMV‐PAS IgG 6. The RNA was reverse‐transcribed and amplified using the following primers derived from the sequence of the RNA1 of an Aschersleben isolate of BaMMV (AJ 242725; Subr et al., 2000): forward primer 5’‐TGCTCGTCACTCTCCTGGT‐3’, cDNA and reverse primer 5’‐GTCTTTTGCGGTCTTGATGA‐3’. DNA fragments of 707‐bp length were obtained and separated by agarose gel electrophoresis, extracted from the gel using the Wizard PCR Purification Kit (Promega, Mannheim, Germany) and cloned into pGEM‐T (Promega) according to the manufacturer’s instructions.…”

Unfolding the secrets of plum pox virus: from epidemiology to genomics

“…Various pathotypes have been mapped to the P3 gene of pea seed-borne mosaic virus (Hjulsager et al, 2006). The toxicity for bacteria in prokaryotic expression experiments and presence of one or two hydrophobic domains indicated the P3 affinity to cellular membranes (Rodríguez-Cerezo and Shaw, 1991;Šubr et al, 2000). Cytological localization of P3 in endoplasmatic reticulum confirmed this hypothesis (Eiamtanasate et al, 2007).…”

“…The plants infected by in vitro transcripts were symptomless and passage used to lead to full extinction of infection due to deleterious mutations (Guo et al, 1998). Subsequently prepared infectious cDNA clone of this isolate called pIC-PPV (López-Moya and García, 2000) was improved by insertion of a plant intron in the gene P3 which has been shown to be toxic for E. coli during the cloning steps (Maiss et al, 1992;Šubr et al, 2000). This clone together with the clone of PPV isolate PS (strain PPV-M) was successfully applied in order to map the pathogenicity determinants in the PPV genome.…”