The diagnosis of delayed post-operative endophthalmitis by polymerase chain reaction of bacterial DNA in vitreous samples

Abstract

Delayed post-operative endophthalmitis is a complication of modern cataract extraction and posterior chamber lens implantation. Propionibacterium acnes has been isolated in a few such cases but the majority are culture-negative, compounding surgical and medical management decisions. A method of detecting bacterial, and specifically P. acnes, DNA by the polymerase chain reaction (PCR) directed at 16S rDNA is reported. Nested PCR with universal eubacterial primers complimentary to regions of 16S rDNA conserved sequences detected 50 fg of bacterial DNA spike in normal vitreous. Nested PCR with P. acnes primers detected 10 fg of DNA. Vitreous samples from 29 patients undergoing vitrectomy for reasons unrelated to infection and 23 samples from 19 patients with delayed post-operative endophthalmitis were analysed. Four (14%) of 29 normal individuals and 17 (74%) of 23 delayed cases gave positive results with universal eubacterial primers. None of 29 and eight of 23 samples gave positive results with P. acnes primers. The 14% positive rate with universal primers in non-infected cases may limit their use in delayed post-operative endophthalmitis. PCR detection of bacterial DNA with specific primers from vitreous samples may prove a useful means of diagnosing delayed post-operative endophthalmitis and facilitating management decisions when conventional bacterial culture is negative.

Molecular biology applied to the laboratory diagnosis of bacterial endophthalmitis

“…Utilizing the nested PCR technique with universal primers and a combination of species-specific primers for Propionibacterium acnes, the method was capable of detecting bacterial DNA in 17 (74%) of 23 specimens of vitreous humor, while the culture was positive in 10 (43.5%) of these specimens. Bacterial DNA was detected by PCR in 8 specimens with a negative culture and in all cases where there was bacterial growth in culture (18) .…”

PCR Detection and Identification of Bacterial Contaminants in Ocular Samples from Post- Operative Endophthalmitis

“…Sampling was conducted under the sterile operating conditions. Viterous aspiration was done slowly using a sterile syringe [17,18]. The specimens were collected in pre-sterilized microfuge tubes and stored at -20˚C for further analysis.…”

“…Bacterial 16S rRNA gene was amplified from genomic DNA isolated from the vitreous samples using PCR with a pair of HAD2 universal primers [18,19]: F 5' ACTCCTACGGGAGGCAGCAGT 3' and R 5'GTATTACCGCGGCTGCTGGCA 3'. The PCR reactions were carried out in a total volume of 25 µl containing 2.5 µl of 10× PCR buffer (CinnaGene, Iran), 25 mM MgCl 2 , 10 mM of dNTP, 2 µl of DNA template (50-500 ng) , 0.1µM of each primer, 1.0 U of Taq DNA polymerase.…”

Surveillance of endophthalmitis following cataract surgery in the UK

“…Should subsequent microbiological cultures prove to be negative, this still does not rule out an infectious aetiology as a significant percentage of infectious cases are not bacteriologically identified by using conventional culture techniques. [12][13][14] One recent study showed that by using the polymerase chain reaction in the diagnosis of bacterial endophthalmitis, 54.8% more samples were positive for bacteria compared to conventional culture methods. 14 Both culture negative and culture positive cases were therefore included in the data analysis for this study.…”