The FA pathway counteracts oxidative stress through selective protection of antioxidant defense gene promoters

Abstract

Oxidative stress has been implicated in the pathogenesis of many human diseases including Fanconi anemia (FA), a genetic disorder associated with BM failure and cancer. Here we show that major antioxidant defense genes are downregulated in FA patients, and that gene down-regulation is selectively associated with increased oxidative DNA damage in the promoters of the antioxidant defense genes. Assessment of promoter activity and DNA damage repair kinetics shows that increased initial damage, rather than a reduced repair rate, contributes to the augmented oxidative DNA damage. Mechanistically, FA proteins act in concert with the chromatin-remodeling factor BRG1 to protect the promoters of antioxidant defense genes from oxidative damage. Specifically, BRG1 binds to the promoters of the antioxidant defense genes at steady state. On challenge with oxidative stress, FA proteins are recruited to promoter DNA, which correlates with significant increase in the binding of BRG1 within promoter regions. In addition, oxidative stress-induced FANCD2 ubiquitination is required for the formation of a FA-BRG1-promoter complex. Taken IntroductionOxidative DNA damage is a major source of genomic instability. The most prevalent lesion generated by intracellular reactive oxygen species (ROS) is 8-hydroxydeoxy guanosine (8-oxodG). This lesion causes G:C to T:A transversion mutations and is considered highly mutagenic. 1 There is compelling evidence that 8-oxodG levels are elevated in various human cancers. 2,3 and in animal models of tumors. 4,5 ROS-induced DNA damage can also result in single-or double-strand breaks, which are lethal to the cell if not repaired. 6,7 Although there is a great deal known about DNA repair, we have a limited understanding of the involvement of specific repair pathways in protecting cellular DNA from oxidative damaging agents, particularly ROS. The major pathways involved in DNA repair include repair of single-base damage by the base excision repair (BER) pathway, repair of lesions that distort the DNA helix by the nucleotide excision repair (NER) pathway, and repair of DNA double-strand breaks by homologous recombination (HR) and nonhomologous end-joining (NHEJ) pathways. [8][9][10] Although the specificity and efficiency of each of these DNA repair pathways is critical to ensure genome stability, the complexity of ROS-induced oxidative DNA damage may require coordination between these different pathways.Cells have developed a battery of defense mechanisms to protect against damage induced by oxidative stress. Antioxidant defense enzymes, including superoxide dismutases, catalase, glutathione peroxidases and peroxiredoxins, as well as nonenzymatic scavengers such as glutathione and carotenoids can directly eliminate ROS. 11 Other cellular enzymes can repair DNA damage induced by ROS. 12 Moreover, ROS can influence the selective activation of oxidative stress-responsive transcription factors.Indeed, the first line of defense against oxidative damage is the induction of stress-response genes, many of whi...

Amelioration of Radiation-Induced Oral Cavity Mucositis and Distant Bone Marrow Suppression in Fanconi Anemia Fancd2–/– (FVB/N) Mice by Intraoral GS-Nitroxide JP4-039

“…Intraoral JP4-039/F15 protected normal tissues in head and neck irradiated Fancd2 −/− mice as well as control Fancd2 +/+ mice. These data confirm prior studies showing that GS-nitroxides, including JP4-039, work at the level of the mitochondria to inhibit apoptosis, and extend these results to tissues and cells from experimental animals with a defective DNA damage response pathway (14, 29–32). …”

The Fanconi anemia pathway has a dual function in Dickkopf-1 transcriptional repression

“…In addition, we observed that GSK3β inhibition triggered activation of the FA pathway as measured by formation of the long form of FANCD2. Recent studies support a role of the FA core complex via FANCD2 in transcription, both activation and repression (25)(26)(27). Taken together, those studies and our results imply that FA core complex activity may modulate β-catenin function.…”

Hydroquinone Increases 5-Hydroxymethylcytosine Formation through Ten Eleven Translocation 1 (TET1) 5-Methylcytosine Dioxygenase

“…Overexpression of the TET1 catalytic domain was used as a positive control. Primers used in hydroxymethylated/methylated DNA immunoprecipitation were as follows: LINE1 forward, TGCGGAGAAATAGGAACACTTTT and reverse, TGAGGAATCGCCACACTGACT (23); 14-3-3 forward, CATTTAGGCAGTCTGATTCC and reverse, GCTCA-CGCCTGTCATCTC (24); glutamate-cysteine ligase catalytic subunit (GCLC) forward, CGTCCCAAGTCTCACAGTCA and reverse, CTTTACGCAAACGCGACATA (25).…”