The Formation of the Fertilization Membrane of the Sea Urchin Egg

Kay, Erica S.; Shapiro, Bennett M.

doi:10.1016/b978-0-12-492603-5.50008-6

Cited by 66 publications

(48 citation statements)

References 116 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…1 and from five other eggs are given in Table II. In two eggs (1 and 2) light emission began close to the egg equator and filled the egg outline in 25 s. In four other eggs, light emission began more diffusely in an area [15][16][17][18][19][20][21][22][23][24][25][26][27][28][29][30] Ixm away from the equator and filled the egg outline in 10-20 s. Since the time to mean peak light emission was similar for all eggs, we assume eggs 1 and 2 to have been examples of equatorial sperm-egg fusion and interpret the spatial distribution of aequorin light emission in the other cases to be the result of a more polar sperm-egg interaction. In the two cases of presumptive equatorial sperm fusion, the local cytoplasmic free calcium concentration was greatest at the site of sperm-egg interaction; in these two cases, mean peak light emission occurred before the free calcium concentration had reached a peak at the antipode.…”

Section: The Increase In Cytoplasmic Calcium At Fertilizationmentioning

confidence: 99%

“…W P'HEN a sea urchin egg is fertilized, the fertilization envelope rises around the egg progressively, starting from the point of sperm entry (2,20,30). The envelope is formed as a result of the exocytosis of cortical secretory granules which lie immediately beneath the plasma membrane of the unfertilized egg (22,24). These granules undergo exocytosis in vitro in response to micromolar concentrations of calcium ions (11,13,40).…”

mentioning

confidence: 99%

See 1 more Smart Citation

The part played by inositol trisphosphate and calcium in the propagation of the fertilization wave in sea urchin eggs.

Swann¹,

Whitaker²

1986

The Journal of Cell Biology

244

133

View full text Add to dashboard Cite

Abstract. Sea urchin egg activation at fertilization is progressive, beginning at the point of sperm entry and moving across the egg with a velocity of 5 ~tm/s. This activation wave (Kacser, H., 1955, J. Exp. Biol., 32:451-467) has been suggested to be the result of a progressive release of calcium from a store within the egg cytoplasm (Jaffe, L. E, 1983, Dev. Biol., 99:265-276). The progressive release of calcium may be due to the production of inositol trisphosphate (InsP3), a second messenger. We show here that (a) a wave of calcium release crosses the Lytechinus pictus egg; the peak of the wave travels with a velocity of 5 ~tm/s; (b) microinjection of InsP3 causes the release of calcium within the egg; (c) calcium release (as judged by fertilization envelope elevation) is abolished by prior injection of the calcium chelator EGTA; (d) neomycin, an inhibitor of InsP3 production, does not prevent the release of calcium in response to InsP3 but does abolish the wave of calcium release; (e) the egg cytoplasm rapidly buffers microinjected calcium; (f) the calcium concentration required to cause fertilization membrane elevation when microinjected is very similar to that required to stimulate the production of InsP3 in vitro; and (g) the progressive fertilization membrane elevation seen after microinjection of calcium buffers appears to be due to diffusion of the buffer across the egg cytoplasm rather than to the induction of the activation wave. We conclude that InsP3 diffuses through the egg cytoplasm much more readily than calcium ions and that calcium-stimulated production of InsP3 and InsP3-induced calcium release from an internal store can account for the progressive release of calcium at fertilization.

show abstract

Section: The Increase In Cytoplasmic Calcium At Fertilizationmentioning

confidence: 99%

mentioning

confidence: 99%

The part played by inositol trisphosphate and calcium in the propagation of the fertilization wave in sea urchin eggs.

Swann¹,

Whitaker²

1986

The Journal of Cell Biology

244

133

View full text Add to dashboard Cite

show abstract

“…It is possibly due to the difficulty of detection of the fertilization membrane elevation. Fertilization membrane is not enough hard to elevate clearly because of lacking of external Ca2+ (11).…”

Section: Resultsmentioning

confidence: 99%

Membrane potential change in a sea urchin egg induced by calcium ionophore A23187 has the same component that is involved in the fertilization potential.

Obata¹,

Kuroda

1989

Cell Struct. Funct.

View full text Add to dashboard Cite

“…Instead, the activating factor is related to cortical changes during fertilization (Battaglia and Shapiro, 1988). The cell surface is transiently acidified between 30-120 seconds after fertilization (Paul et al, 1976;Smith et al, 2002), timing that is coordinate with exocytosis of cortical granule contents (Chandler and Heuser, 1979;Haley and Wessel, 2004;Kay and Shapiro, 1985;Matese et al, 1997) and with peak transamidation activity (Battaglia and Shapiro, 1988). Might acidic environments activate the transglutaminases, as observed for the teleost…”

Section: Environmental Acidification Activates Extracellular Transglumentioning

confidence: 99%

Extracellular matrix modifications at fertilization: regulation of dityrosine crosslinking by transamidation

Wong

Wessel

2009

Development

View full text Add to dashboard Cite

Fertilization is accompanied by the construction of an extracellular matrix that protects the new zygote. In sea urchins, this structure is built from glycoproteins residing at the egg surface and in secretory vesicles at the egg cortex. Four enzymatic activities are required for the transformation of these proteins into the mechanically and chemically resilient fertilization envelope: proteolysis, transamidation, NADPH-dependent oxidation and peroxidation. Here, we identify the Strongylocentrotus purpuratus enzymes responsible for the formation of ε(γ-glutamyl)lysine crosslinks (transamidation). We find that these two transglutaminases are activated by local acidification and act on specific substrates within the fertilization envelope (including ovoperoxidase, rendezvin and SFE9). Surprisingly, these enzymes also regulate dityrosine crosslinking both by direct conjugation of ovoperoxidase and by modulating hydrogen peroxide production. Together, these results emphasize how transglutaminases can coordinate the activities of other enzymes during extracellular matrix transmogrifications. Development 136, 1835Development 136, -1847Development 136, (2009Development 136, ) doi:10.1242 Department of Molecular Biology, Cell Biology, and Biochemistry, Box G-L173, 185 Meeting Street, Brown University, Providence, RI 02912, USA. KEY WORDS: Extracellular matrix, Fertilization, Transamidation, Transglutaminase, Sea urchin*Author for correspondence (e-mail: rhet@brown.edu) Accepted 9 March 2009 DEVELOPMENT MATERIALS AND METHODS AnimalsStrongylocentrotus purpuratus gametes were obtained and handled as previously described . RNA in situ hybridizationAntisense digoxigenin-labeled RNA probes (DIG RNA Labeling Kit (SP6/T7); Roche Diagnostics Corporation, Indianapolis, IN, USA) representing S. purpuratus eTG (nucleotides 1274 to 1802) and nTG (nucleotides -62 to 403) or negative control probe (neomycin phosphotransferase II) were used at 0.1 μg probe/ml to detect native transcript in oocytes according to previously published protocols (ArenasMena et al., 2000). Quantitative PCRReal-time quantitative PCR was conducted on about 0.1 μg-equivalents of total RNA isolated from hand-collected oocytes or eggs (Song et al., 2006). Primers representing the 3Ј-end of each transglutaminase open reading frame were used to amplify products for eTG (199 bp using F=5Ј CACT-GAGGATTTGATGGTTGG with R=5Ј GGTTGCCTGTCTTCTTTGGT) and nTG (169 bp using F=5Ј CCACCGGAGATGAAGACTGA with R=5Ј TTGCCCTTTGAAGGAACATC), and cycle numbers were normalized to ubiquitin (~147 bp using F=5Ј CACAGGCAAGACCATCACAC; R=5Ј GAGAGAGTGCGACCATCCTC). Each PCR reaction was run off of cDNA (TaqMan Reverse Transcription kit; Applied Biosystems, Foster City, CA, USA) using Platinum SBYR Green qPCR SuperMix-UDG with ROX (Invitrogen Corporation, Carlsbad, CA, USA) on a 7300 Real-Time PCR System (Applied Biosystems, Foster City, CA, USA). Production of polyclonal antiseraAntiserum was raised in rabbits against bacterially overexpressed, recombinant fragments subcloned downstream of ...

show abstract

The Formation of the Fertilization Membrane of the Sea Urchin Egg

Cited by 66 publications

References 116 publications

The part played by inositol trisphosphate and calcium in the propagation of the fertilization wave in sea urchin eggs.

The part played by inositol trisphosphate and calcium in the propagation of the fertilization wave in sea urchin eggs.

Membrane potential change in a sea urchin egg induced by calcium ionophore A23187 has the same component that is involved in the fertilization potential.

Extracellular matrix modifications at fertilization: regulation of dityrosine crosslinking by transamidation

Contact Info

Product

Resources

About