The Genome-Wide Interaction Network of Nutrient Stress Genes in Escherichia coli

Abstract

Conventional efforts to describe essential genes in bacteria have typically emphasized nutrient-rich growth conditions. Of note, however, are the set of genes that become essential when bacteria are grown under nutrient stress. For example, more than 100 genes become indispensable when the model bacterium Escherichia coli is grown on nutrient-limited media, and many of these nutrient stress genes have also been shown to be important for the growth of various bacterial pathogens in vivo. To better understand the genetic network that underpins nutrient stress in E. coli, we performed a genome-scale cross of strains harboring deletions in some 82 nutrient stress genes with the entire E. coli gene deletion collection (Keio) to create 315,400 double deletion mutants. An analysis of the growth of the resulting strains on rich microbiological media revealed an average of 23 synthetic sick or lethal genetic interactions for each nutrient stress gene, suggesting that the network defining nutrient stress is surprisingly complex. A vast majority of these interactions involved genes of unknown function or genes of unrelated pathways. The most profound synthetic lethal interactions were between nutrient acquisition and biosynthesis. Further, the interaction map reveals remarkable metabolic robustness in E. coli through pathway redundancies. In all, the genetic interaction network provides a powerful tool to mine and identify missing links in nutrient synthesis and to further characterize genes of unknown function in E. coli. Moreover, understanding of bacterial growth under nutrient stress could aid in the development of novel antibiotic discovery platforms.

The Adaptive Morphology of Bacillus subtilis Biofilms: A Defense Mechanism against Bacterial Starvation

“…To offset sub-optimal growth conditions, bacteria develop a number of different adaptation mechanisms, or "stress responses". These include, but are not limited to, dormant endospore formation, lowered metabolic rate, altered cell morphology [1], changes in gene expression [2], and protein synthesis.…”

Conserved Pyridoxal 5'-Phosphate-Binding Protein YggS Impacts Amino Acid Metabolism through Pyridoxine 5'-Phosphate in Escherichia coli

“…Nichols et al showed that yggS and glyA, encoding serine hydroxymethyl transferase, are a synthetic lethal pair in E. coli (6). Impaired growth of the yggS glyA double-knockout mutant was also identified in the genome-scale cross of the glyA mutant with the entire E. coli gene deletion collection (7). Later, it was found that the double mutant can grow in a synthetic medium supplemented with Gly (3), which indicated that the gene pair is a conditional lethal mutant.…”

A macrophage-based screen identifies antibacterial compounds selective for intracellularSalmonellaTyphimurium

“…Briefly, the chloramphenicol resistance cassette from pKD3 was amplified by PCR with primers 5’-CAATTATTTTTACAAATTGATCAGCGCTAAATACTGCTTCACAACAAGGAGTAGGCT GGAGCTGC-3’and 5’-AGACCTACAAGGGCACAGGTCTGATAAGCGCAGCGCCAGCGAATAACTTACATATG AATATCCTCCTTAGTTCC-3’ and the resulting amplicon was transformed into electro-competent S . Tm SL1344 cells harboring the pSim6 plasmid as previously described 57,58 . Successful recombinants were confirmed by colony PCR using primers 5’CGACCATCTCCAGCAGCCAC-3’ and 5’GAAAAGGCGAGAATGCGGCG-3’.…”