The Glutamic Acid Decarboxylase System of the New Species Brucella microti Contributes to Its Acid Resistance and to Oral Infection of Mice

Occhialini, Alessandra; Bagüés, María Pilar Jiménez de; Saadeh, Bashir; Bastianelli, Daniela; Hanna, Nabil; Biase, Daniela De; Köhler, Stephan

doi:10.1093/infdis/jis522

Cited by 34 publications

(66 citation statements)

References 22 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Genes involved in acid resistance are located on region 9, which encodes the Hfq-regu- lated gene hdeA that has been shown to be required for resistance to mild acid shock (41). The gad operon, which produces the nonproteinogenic amino acid ␥-aminobutyric acid (GABA), conferring resistance to strong acid (ϽpH 3) in B. microti (42), is also encoded here (VBIBruSui107850_2552 and VBIBruSui107850_ 2553). This region seems to be undergoing degradation in the classical species, because several genes are nonfunctional due to frameshifts or stop codons.…”

Section: Resultsmentioning

confidence: 99%

Comparative Phylogenomics and Evolution of the Brucellae Reveal a Path to Virulence

et al. 2014

View full text Add to dashboard Cite

h Brucella species include important zoonotic pathogens that have a substantial impact on both agriculture and human health throughout the world. Brucellae are thought of as "stealth pathogens" that escape recognition by the host innate immune response, modulate the acquired immune response, and evade intracellular destruction. We analyzed the genome sequences of members of the family Brucellaceae to assess its evolutionary history from likely free-living soil-based progenitors into highly successful intracellular pathogens. Phylogenetic analysis split the genus into two groups: recently identified and early-dividing "atypical" strains and a highly conserved "classical" core clade containing the major pathogenic species. Lateral gene transfer events brought unique genomic regions into Brucella that differentiated them from Ochrobactrum and allowed the stepwise acquisition of virulence factors that include a type IV secretion system, a perosamine-based O antigen, and systems for sequestering metal ions that are absent in progenitors. Subsequent radiation within the core Brucella resulted in lineages that appear to have evolved within their preferred mammalian hosts, restricting their virulence to become stealth pathogens capable of causing long-term chronic infections. The Alphaproteobacteria are an ecologically diverse group of Gram-negative bacteria among which several lineages evolved from niches in the environment toward obligate intracellular parasitism of diverse eukaryotic hosts. The adaptation of certain Alphaproteobacteria to intracellular life within a host has been associated with genome reduction, resulting in the loss of genes no longer necessary in this specialized environment (1, 2). Free-living bacteria in water or soil must exploit diverse conditions and compete with other organisms in these environments, while bacteria that reside within host cells encounter less competition but are exposed to different stresses (3, 4). As facultative intracellular pathogens, Brucella species establish long-term, often chronic, interactions with higher eukaryotes (1) but also must survive outside the host. This genus includes species considered among the world's most important zoonotic pathogens (5) with a major impact in the poorer, rural areas of the world that lack the resources to establish surveillance and eradication programs for livestock. Brucellae use virulence factors, including a type IV secretion system (T4SS), to modulate host cell biology to create a novel intracellular replication niche in both professional and nonprofessional phagocytes (6), causing infectious abortion and sterility in infected animals and a debilitating disease known as Malta fever in humans.For many years the genus Brucella comprised six "classical" species differentiated by a preferential mammalian host and a set of antigenic and metabolic phenotypes. Since the early 1990s, new Brucella strains have been isolated from marine mammals, rodents, and atypical human infections, raising the number of recognized species to 10 (5), wi...

show abstract

Section: Resultsmentioning

confidence: 99%

Comparative Phylogenomics and Evolution of the Brucellae Reveal a Path to Virulence

et al. 2014

View full text Add to dashboard Cite

show abstract

“…The primers used in this study were the following: ⌬gadA_for, 5=-TTCGAAATGGACCAGAAGCTGTT AACGGATTTCCGCTCATGTAGGCTGGAGCTGCTTC-3=; ⌬gadA_rev, 5=-TCAGGTGTGTTTAAAGCTGTTCTGCTGGGCAATACCCTGATTC CGGGGATCCGTCGACC; ⌬gadB_for, GATTTAAGGTCGGAACTACT CGATTCACGTTTTGGTGCGTGTAGGCTGGAGCTGCTTC-3=; ⌬gadC_ rev, 5=-TTAGTGTTTCTTGTCATTCATCACAATATAGTGTGGTGAA ATTCCGGGGATCCGTCGACC-3=. Homologous and heterologous complementations of the triple mutant were obtained by transformation with the vector pBBR1MCS carrying the complete gadBC operon of E. coli or Brucella strains, each including its native promoter, as reported (23). A 3.6-kb DNA fragment of each Brucella species containing the gadB and gadC genes was amplified by PCR using the long-extend and high-fidelity Platinum Taq polymerase (Invitrogen) and the gadBC-op_PstI-For (GC CCTGCAGCCGAGCTTATTGCGCTAATATC) and gadBC-op_XbaI-Rev (GCCTCTAGAATCGCATCTGATGAGCTTGAC) primers (Sigma).…”

Section: Methodsmentioning

confidence: 99%

“…Assays with Brucella spp. and E. coli wild-type and mutant strains were carried out in minimal media as previously described (15,23), namely, modified Gerhardt's (GMM without glutamate) for Brucella spp. and Vogel Bonner's medium with 0.4% glucose (EG) for E. coli; both media were brought to pH 2.5 with HCl and used in the presence/absence of 1.5 mM Glu.…”

Section: Methodsmentioning

confidence: 99%

“…The cleared cell lysates were immediately assayed for protein content (26) and GAD activity (27). The concentration of GABA exported by E. coli and by Brucella in acidified medium was measured using a commercial biochemical GABase assay (Sigma), as described previously (15,23).…”

Section: Methodsmentioning

confidence: 99%

“…B. microti grows faster and is more resistant to pH 4.5 in vitro than classical Brucella strains, such as B. suis 1330 (22). The B. microti GAD system is fully active, i.e., it confers resistance to extreme acid stress (pH 2.5), and also contributes to infection transmitted through ingestion in mice (23).…”

mentioning

confidence: 99%

See 2 more Smart Citations

Glutamate Decarboxylase-Dependent Acid Resistance in Brucella spp.: Distribution and Contribution to Fitness under Extremely Acidic Conditions

Damiano

Bastianelli

Dahouk

et al. 2015

Appl Environ Microbiol

Self Cite

View full text Add to dashboard Cite

f Brucella is an expanding genus of major zoonotic pathogens, including at least 10 genetically very close species occupying a wide range of niches from soil to wildlife, livestock, and humans. Recently, we have shown that in the new species Brucella microti, the glutamate decarboxylase (Gad)-dependent system (GAD system) contributes to survival at a pH of 2.5 and also to infection in mice by the oral route. In order to study the functionality of the GAD system in the genus Brucella, 47 isolates, representative of all known species and strains of this genus, and 16 strains of the closest neighbor genus, Ochrobactrum, were studied using microbiological, biochemical, and genetic approaches. In agreement with the genome sequences, the GAD system of classical species was not functional, unlike that of most strains of Brucella ceti, Brucella pinnipedialis, and newly described species (B. microti, Brucella inopinata BO1, B. inopinata-like BO2, and Brucella sp. isolated from bullfrogs). In the presence of glutamate, these species were more acid resistant in vitro than classical terrestrial brucellae. Expression in trans of the gad locus from representative Brucella species in the Escherichia coli MG1655 mutant strain lacking the GAD system restored the acid-resistant phenotype. The highly conserved GAD system of the newly described or atypical Brucella species may play an important role in their adaptation to acidic external and host environments. Furthermore, the GAD phenotype was shown to be a useful diagnostic tool to distinguish these latter Brucella strains from Ochrobactrum and from classical terrestrial pathogenic Brucella species, which are GAD negative. Brucellae are the etiologic agents of brucellosis, the most widespread bacterial zoonosis, infecting livestock and humans (human incidence, 500,000/year). The disease is endemic in the Mediterranean, in Near East and Middle East countries, and in Latin America (1, 2). These pathogens are classified as different species on the basis of specific phenotypic traits and their natural hosts (3): Brucella melitensis (isolated from goats and sheep), Brucella abortus (cattle and bison), Brucella suis (pigs and wild boar), and Brucella canis (dogs). Transmitted to humans via the mucosal, cutaneous, respiratory or, most frequently, oral route, these species may induce undulant fever (Malta fever) and a wide range of clinical manifestations, including encephalitis and endocarditis. With a few exceptions, Brucella species isolated from marine mammals (Brucella pinnipedialis and Brucella ceti) have not been described as human pathogens. Two other species are nonpathogenic for humans: Brucella ovis (sheep) and Brucella neotomae (desert woodrat) (3). Being known for 20 years or longer, these eight species are considered "classical". More recently, three "new" species/strains were identified: B. microti from common vole, red fox, and also soil (4-7) and Brucella inopinata BO1 and B. inopinata-like BO2 from patients with a breast implant infection (8, 9) and a chronic destructiv...

show abstract

Global Rsh‐Dependent Transcription Profile ofBrucella SuisDuring Stringent Response Unravels Adaptation to Nutrient Starvation and Cross‐Talk with Other Stress Responses

Köhler

Hanna

Ouahrani‐Bettache

et al. 2016

Stress and Environmental Regulation of Gene Expression and Adaptation in Bacteria

Self Cite

View full text Add to dashboard Cite

Background: In the intracellular pathogen Brucella spp., the activation of the stringent response, a global regulatory network providing rapid adaptation to growth-affecting stress conditions such as nutrient deficiency, is essential for replication in the host. A single, bi-functional enzyme Rsh catalyzes synthesis and hydrolysis of the alarmone (p) ppGpp, responsible for differential gene expression under stringent conditions. Results: cDNA microarray analysis allowed characterization of the transcriptional profiles of the B. suis 1330 wildtype and Δrsh mutant in a minimal medium, partially mimicking the nutrient-poor intramacrophagic environment. A total of 379 genes (11.6% of the genome) were differentially expressed in a rsh-dependent manner, of which 198 were up-, and 181 were down-regulated. The pleiotropic character of the response was confirmed, as the genes encoded an important number of transcriptional regulators, cell envelope proteins, stress factors, transport systems, and energy metabolism proteins. Virulence genes such as narG and sodC, respectively encoding respiratory nitrate reductase and superoxide dismutase, were under the positive control of (p)ppGpp, as well as expression of the cbb3-type cytochrome c oxidase, essential for chronic murine infection. Methionine was the only amino acid whose biosynthesis was absolutely dependent on stringent response in B. suis. Conclusions: The study illustrated the complexity of the processes involved in adaptation to nutrient starvation, and contributed to a better understanding of the correlation between stringent response and Brucella virulence. Most interestingly, it clearly indicated (p)ppGpp-dependent cross-talk between at least three stress responses playing a central role in Brucella adaptation to the host: nutrient, oxidative, and low-oxygen stress.

show abstract

The Glutamic Acid Decarboxylase System of the New Species Brucella microti Contributes to Its Acid Resistance and to Oral Infection of Mice

Abstract: This work provides first evidence that the GAD system might play an essential role in the resistance of an environment-borne, pathogenic Brucella species to extreme acid shock and during passage through the host stomach following oral infection.

Cited by 34 publications

References 22 publications

Comparative Phylogenomics and Evolution of the Brucellae Reveal a Path to Virulence

Comparative Phylogenomics and Evolution of the Brucellae Reveal a Path to Virulence

Glutamate Decarboxylase-Dependent Acid Resistance in Brucella spp.: Distribution and Contribution to Fitness under Extremely Acidic Conditions

Global Rsh‐Dependent Transcription Profile ofBrucella SuisDuring Stringent Response Unravels Adaptation to Nutrient Starvation and Cross‐Talk with Other Stress Responses

Contact Info

Product

Resources

About